The following is a 20+ point long summary post why Bailey makes a poor suspect in this case. Because of the 40k limit on posts, I cannot go into all details but I have linked to other posts where these subjects are dealt with in more detail.

Much of this is covered in the DPP's report. I recommend that you read this report carefully first. https://syndicatedanarchy.wordpress.com/

However this report dates from 2001 and many things came to light since, including the Bandon Tapes & Marie Farrell's retraction. So this post can be considered an update of that report, further demonstrating that there is not case against Bailey.

If you wish to know more about a specific point or debate it, please reply to this thread with the bullet point you wish to discuss.

1 Absence of Forensic evidence

It is a myth to say that little or no forensic evidence was found. There were some delays in getting to the scene, but the technicians were on scene within 12 hours. Although the scene was outside, weather conditions were ideal for the preservation of evidence, cold and dry.

This was an incredibly bloody crime scene. The murderer would have transferred blood wherever he went, in his car, house, clothes. Bloodstains remain detectable after washing. Indeed faint bloodstains were detected on a number of items of clothing in Bailey's possession (e.g. a rugby shirt) but DNA testing proved these stains to be from him and not Sophie.

In 2011 the French retested the exhibits and found an unknown male DNA profile on Sophie’s boot. This profile doesn’t match Bailey. The French said nothing about this bombshell at the time, nor at the 2019 trial where they convicted Bailey in absentia, or since.

Apart from unidentified DNA, unidentified fingerprints, bootprints and tyre tracks were found at the scene. Despite considerable effort to charge Bailey, none of this was linked to him.

For a detailed breakdown of all the tests done on the scene including the DNA profile found on her body, see the following post: https://www.reddit.com/r/MurderAtTheCottage/comments/vraf9q/forensic_tests_on_the_body_exhibits_and_crime/

2 Bailey was not the first person to call it a murder

It was known to be a murder from the first 999 call, we found this out from the French interviews of the 999 operator. The responding Gardai used the word “murder” over open airwaves and the media learned of it possibly even before police arrived at the scene at 10:38. The news spread very quickly from 10:30am. Saffron Thomas claimed to have heard about it in Adele’s coffee shop in Schull in the morning. The murder was on the radio at 12, and it was announced the victim was French on the 2pm bulletin.

Here is an excerpt from the statement of retired Garda Eugene McCarthy who spoke with French investigators in 2011:

Q – Can you spontaneously tell us what happened?

A – I got a call from the neighbouring man who was very distressed. I felt it was a murder. I don’t think he said, so I’m not sure. I passed the message to Bantry Garda station explaining that I felt it was a murder not to say it over the airwaves.

Q – That was your person opinion?

A – Yes. I subsequently heard Schull Station giving the call to the Schull car on the radio. He mentioned it was a murder. I rang Bantry back to tell them not to say it over the air. Because people listened into radio messages at the time. Bantry I presume contacted Schull by telephone.

Every Garda station in Cork would have heard this.

3 Bailey did not come suspiciously quickly to the crime scene, he was late, and he had directions

We know this because another West Cork based reporter (Niall Duffy) was on the scene twenty minutes after Bailey, but he came from Eyeries which is 90 minutes drive from Dunmanus. If Bailey knew about the murder from the early morning or night before, surely he would have been glued to the radio, waiting for word to leak out so he could plausibly be the first on the scene. Instead he did nothing until he got an unexpected phone call from Eddie Cassidy. When he did get the call he drove to Dunmanus because Cassidy gave him directions, as we know from the DPP’s report. Eddie Cassidy got directions from Superintendent Twomey as both their statements attest. Cassidy's statement reads:

he told me that if I passed the Altar Restaurant and over the hump-back bridge and turned right before Sylvia O’Connell’s and said that you probably would not be able to get a photograph cause the road was closed off.

Auctioneer Dermot Sheehan got a call from Cassidy shortly after Bailey did. His statement reads:

He explained the exact location of the house almost and as a result of he telling me of the location that I told him the names of people that I knew lived nearby.

That the victim was French was already broadcast on the radio at 2pm. Bailey remembers he heard that she was French from Cassidy and there is direct evidence that Cassidy told Anne Mooney, Mooney told the radio announcer Cathy Farrell. The DPP's report breaks this chain down in detail using Eddie Cassidy's phone records and witness statements.

4 Bailey could not have been at the crime scene early in the morning, did not see the body

The scene was guarded from 10:38 and the local doctor was on the scene at 11 until 11:30. The priest arrived shortly after this. More Gardai arrived at 11:55 and Josie Hellen arrived just after them. Finbarr Hellen arrived about 12:30 and identified the body. If Bailey had been there early he would have been seen. If he was watching, he would not have accused the Gardai of letting Shirley Foster drive past the body. His interrogation and writings show was unaware of this fact, that she had already driven past the body and parked before the police were called. This detail was not publicly known before 2011.

He also wrote in the Daily Star that Finbarr Hellen discovered the body, another basic mistake which he wouldn't have made if he was watching that morning.

Also not known publicly until 2008, was the fact that the victim had been caught on a barbed wire fence. It is one of the most striking things about the crime scene. All of the people who saw the body first hand (before it was covered by a plastic tarp) remarked on this in their statements. The torn leggings stretched a meter from the body making a weird white triangle shape. In a diary entry from 1997 Bailey wrote down the story from his own perspective. He wrote the Shirley Foster stopped her car before the body. He mentioned nothing about barbed wire, and wrote the body was "crouched" by a five bar gate. This was incorrect, it was flat on its back. Shirley told people she saw a "bundle" and this is perhaps what prompted Bailey to say it was "crouched".

Either Bailey never saw the body or he was deliberately fabricating misinformation in his private diaries. If it is the latter he should have filled his diary with other deliberate errors. The only rational conclusion is that he never saw the body in situ.

5 Bailey did not take photos of the crime scene before the police arrived

Bailey called the Independent offering photos of the scene. However, when he was quizzed by a photographer about these photos in detail he admitted Jules Thomas took them. In fact Thomas did take photos when they both visited the scene at 2:20pm. Mike McSweeney decided the photos were not editorially useful and threw them away. Journalist Ann Cahill looking at these photos, but she said they showed the hat of a garda.

At the scene, Bailey offered photos to Dan Linehan (Examiner) but he declined because Bailey hadn't gotten anywhere nearer than he had.

Bailey could not have been secretly at the crime scene before 2pm, unless he was there in the very early morning, in which case he would have needed a flash to take pictures. Flash makes no sense with telephoto shots, and if he was close enough to use a flash, how could he have sold such photos to newspapers? The accusation makes no sense.

6 Bailey showed no unique insight into the crime in his news articles or any of his writings

In fact Bailey was scooped by other journalists, e.g. by the Sunday World, who learned all about the inside of the house from speaking to her housekeeper Josie Hellen. The fact that there was no evidence of sexual assault was leaked by Gardai on the evening of the 24th, right after the post mortem. It appeared in many papers starting on the 24th. Bailey didn't write this until 26th.

The details of wine glasses in the house, a missing poker, what she was wearing, her injuries, that there was a clump of hair in her hands, that she had wounds to the back of her head all appeared in other newspapers before Bailey wrote about them.

For a detailed analysis of Bailey's writings see the following post: https://www.reddit.com/r/MurderAtTheCottage/comments/ut68pd/bailey_knew_too_much_too_soon/

7 Scratches evidence is worthless and prejudiced.

The Gardai appealed to the public for help on 25th December (Irish Times) saying Sophie had scratched her attacker. Despite this, nobody mentioned anything about scratches on Bailey until over a week after the discovery on 31st December when two police went to visit Bailey and specifically asked him to show his arms. Note that Bailey was already a suspect at this stage. Even though the Gardai had made appeals for individuals with scratches from 25th, none of those who met Bailey in the days after the murder mentioned scratches in any of their early statements, even when he was nominated as a suspect. It was only after his arrest (six weeks afterwards) that statements were taken about this from any witnesses. Unsurprisingly most people could not remember scratches on Bailey in the pub two months previously.

When asked, four witnesses (Saffron Thomas, Virginia Thomas, Jules Thomas & Richard Tisdall) said Bailey had light scratches on his arms or hands on the Sunday before the murder. Bailey’s explanation – that he got scratches cutting of the Christmas tree and the killing of three 15-20kg turkeys on the Sunday was corroborated by Saffron Thomas and others.

Bailey spent hours in the company of journalists and police on the morning of the 23rd but none of these noted that he had scratches on his hands or face. Photographs from that day show Bailey wasn’t wearing a hat.

Arianna Boarina’s statement that Bailey was scratched was taken in 1999, over two years afterwards, and she didn't arrive until the 23rd so cannot testify that Bailey had no scratches on the Sunday. Florence Newman, who took one of the Christmas Swim videos, claimed Bailey had scratches like "random squiggles" but she made this statement ten years later in 2006, despite making two previous statements, one of them mentioning Bailey, saying nothing about scratches. Her testimony also contradicts the video she shot. She claimed kept his hands deep in his pockets. In the video you can see him waving his hands around.

The Gardai went around specifically asking if Bailey was scratched after he was arrested, publicly named and damned, so this evidence is prejudiced. Witnesses are suggestible and will "remember" all sorts of things to help the Gardai.

8 Marie Farrell’s witness testimony is unreliable and in any case does not fit Bailey's appearance

Marie Farrell first statement made on 27th December said Sophie called to her shop at 3pm on Saturday 21st. In the same statement she saw a man outside the shop between 2pm and 3pm.

He was approx 5’10” in height, late 30’s, scruffy looking, long black coat, flat black beret, thin build, sallow skin, short hair.

She claimed she saw the same man at 7:15am on Sunday morning at Airhill, Schull. People who believe Bailey is guilty are fond of saying that Farrell stuck to her story for 10 years before she recanted. In fact Farrell’s story changed with every statement she made. A man with sallow skin, thin build, short hair, 5 foot 8 wearing a beret grew to be a man 5’10” tall and then into a man who was “very tall” and then Bailey, a man with long hair, 6’4” and of a strong muscular build, a former rugby player with white, pasty skin. The beret was also noted by Dan Griffin who saw the same man. This detail seems to have been forgotten. Bailey was never known to wear a beret. No black beret was seized from his house. Dan Griffin’s description also changed mid January when Gardai wanted Bailey as a suspect. Restauranteur John Evans also saw a man in a long black coat in Schull on the same day, a man who appeared French/Italian to him. Evans knew Bailey but didn’t identify him in his statements.

The second sighting Farrell said she saw this man in Airhill on Sunday Morning at 7:15am. Gardai tried to link this Bailey because he was staying at a friends house nearby. However, the house he was staying in was on Ardnamanagh road over 500m away and Bailey did not leave the house between 3am and 12 noon, according to witnesses at the house. Also, the man seen by Farrell was hitching a lift towards Schull, not west towards Bailey's home.

The final sighting was at 3am on Kealfadda Bridge. Farrell was simultaneously giving statements to the guards in person while she was secretly phoning in tips as “Fiona” about a sighting at 3am on the morning of 23rd at Kealfadda Bridge. But Kealfadda bridge is not on the way to Lissacaha where Bailey lived. In addition she reported this man was on the western side of the junction and was walking west which is the wrong direction if the man was Bailey walking home. In any case it is almost 3km from Sophie’s cottage so even if Bailey was at Kealfadda Bridge that night, it is not terribly incriminating. Needless to say, the reliability of making a positive identification of someone in the pitch dark from a moving vehicle is low.

But she was not alone in the car. Despite this she refused to divulge who was with her, saying that her husband would be angry because she was with a former lover. She stuck to this implausible excuse long after her husband (and the whole country) knew. Eventually she gave a name, Jan Bartells, but he was in Longford at the time and it turned out Farrell named him out of a desire to get revenge on him. Then she gave a different name, Oliver Croaghan, conveniently dead when she named him and he was not in West Cork at the time. Finally, under threat of prosecution for perjury, she named a third man, John Reilly from Longford and said he was also dead. No record of this man has ever been found, despite checks of birth lists & electoral rolls. She also changed her story about the route she took, the time and whether she was a passenger or the driver.

As regards her accusations of witness intimidation, it was she who approached Bailey in June 1997. On one of the dates Bailey is accused of intimidation, he was visiting his solicitor in Cork City.

Farrell says she was encouraged to identify Bailey as this man after being shown a video of him at Garda Kevin Kelleher's house on 28th December. This fits with Dan Griffin's second statement. This statement is not well known, but when you read it, you can see the Gardai are clearly trying to encourage him to finger Bailey.

On Saturday 12th January 1997 I was made aware of a man being in the Bunratty Inn bar. I went there and looked around but could not say if the man I saw was there.

So the Gardai have clearly sent Griffin to the bar to check if it was Bailey he saw. Later on he does identify Bailey but in a rather bizarre way:

I now know that the man I saw on 12th January 1997 was Ian Bailey as I have since spoken to people including my daughter Bernie who knows him.

So is Farrell's testimony worthless? Not entirely. Her early statements of seeing a man in a black coat and beret in Schull were corroborated by other witnesses, we can probably say it wasn’t completely made up, but otherwise her credibility is nil and it rules out Bailey as the man she saw. She saw someone on Main St, and she saw him again on Sunday morning. Maybe she saw a man at Kealfadda bridge or maybe she made it up to please the Gardai. None of these three sightings can be considered very reliable. The first was when the man was across the street 17m away (50 ft), the next was from moving vehicle and the third was from a moving vehicle on an unlit road, at night time. Dan Griffin's sighting was from 70 feet away and only saw the man from behind. It is impossible to reliably identify anyone under these conditions, or even be certain the man was the same on all three occasions. So there is no connection between the man in the long black coat (whoever he was) and the crime.

9 Admissions evidence is ambiguous and inconsistent and weak

See the DPP’s report on how all the various admissions fall apart under scrutiny. Bailey was making a joke to Hellen Callanan. Bailey was asked did he tell anyone else and he told the Gardai he said the same thing to Yvonne Ungerer. So Bailey informed on himself. Yvonne confirmed she thought it as a joke. Malachy Reed took a lift from Bailey and was "in good form" according to his mother. The next day a Garda interrogated him in school without his parents present and it was only then he came home in a panic and made a statement about Bailey "bashing her brains in". Bailey said he misunderstood. People were saying he did this. Reed continued to take lifts from Bailey after this. At the time he testified in the libel trial, the Gardai had just arrested him for cannabis possession and were threatening prosecution. Billy Fuller was so convinced Bailey was guilty he went searching for the murder weapon on Ballyrisode strand, and hallucinated seeing Bailey and chasing him when in fact a local farmer was present. Bailey was not in Schull that day. Richie Shelley surprised Bailey when he was half asleep and this admission has no particular detail. They waited 7 months to go to the Gardai.

The judgement against Bailey in the 2004 libel trial actually weakens the evidence for murder from his admissions, because Judge Moran wrote that “Mr. Bailey is a man who likes a certain amount of notoriety” i.e. In Judge Moran's estimation, Bailey had a motive for making false or ironic admissions.

In relation to the Shelleys he wrote:

What is the effect of that admission? I think it goes back possibly to Mr. Bailey being a man looking for notoriety, self-publicity seeking and was probably drink induced as well.

and in relation to Malachy Reed

I think this was a form of bravado really on Mr. Bailey's part trying to impress this young 14-year-old for whatever reason

For a detailed analysis of Bailey's admissions see the DPP's report.

https://syndicatedanarchy.wordpress.com/

10 Arrest: Bailey had no memory of the murder and wanted to be hypnotized

By late January 1997, the Gardai were under pressure to make progress. They knew they had little or no evidence on Bailey, but they gambled that if the arrested him and Jules Thomas and subjected them to an intense, aggressive interrogation, they could get a confession from one or the other. The Gardai were well practiced at getting confessions as the cases of the Sallins train robbery, Kerry Babies, Dean Lyons, all showed.

After Bailey was released from custody, he could not go home and was driven to his friend Russell Barrett's house. While there he told Barrett he had no memory of the murder but if the Gardai said he did it, and had been seen by witnesses then maybe he had committed the murder but blacked out due to drink.

Essentially Bailey was now questioning his own reality. He asked to fetch Irma Tullock, Barrett's sometime girlfriend, a counsellor and hypnotist. Bailey trusted Tullock, because she had helped him after he assaulted Jules Thomas in May 1996.

He wanted Tullock to hypnotise him to see if what the Gardai said was possible, because he had no memory of it.

Tullock was interviewed by Gardai two weeks later. She wrote in her statement that Bailey talked in circles and appeared to have been subjected to "inappropriate interrogation techniques".

If ever there there was a time when Bailey would have made a true confession it was then. The interrogation had left him ready to confess, but he couldn't do so because he had no memory of it. It is simply not reasonable for Bailey to have committed a sustained violent attack culminating in murder and have no memory of the event. Bailey would hardly have woken up the next day covered in blood and suspected nothing.

11 Arrest: Jules Thomas’s interrogation and dodgy statement

Bailey didn’t confess, but in the final minutes of her 12 hour detention Jules Thomas signed a statement from her that certainly helped the Gardai make their case. It undermined his alibi, undermined his explanation for the scratch on his forehead. It provided the crucial criminal opportunity for Bailey to commit the murder, because she said that he had seen Sophie in town on Saturday and that he had seen a light on at the house of Alfie Lyons, neighbour of the victim, on the night of the murder. Finally she stated that he told her he was intending to travel to Alfie’s that night. This placed him at the scene of the crime, at the time of the crime, with knowledge of the victim, and with a fresh wound on his forehead that was not there before the murder.

But three days later, Thomas went on the Pat Kenny radio show and blew the case apart. She repudiated everything saying:

I was pretty well forced to make a statement or they were going to take me down and charge me, so I was thinking of the consequences I have three daughters, two at college and one at home and I was thinking of the consequences and I knew I had to make a statement and at the end of the day I did say that if he had done it, I would never want to see him again. The whole idea of being close to a murderer would, you know like any woman, feel absolutely appalling.

In fact we have Jules Thomas' custody record, memos of her interrogation and it is very fishy. The memos of her interrogation were not signed by her and for the final seven hours of her interrogation there are no memos at all. She saw a solicitor briefly around 5pm and after this she was subjected to 7 hours of interrogation after which this statement was produced. There are no memos signed or unsigned for this period, no question/answer sessions, nothing, just a six page statement using legalistic Garda idioms, neatly handwritten by Garda Jim Fitzgerald with no corrections.

Even so, it is clear that this statement didn’t help the Gardai much. She confirmed Bailey got scratches on his arms from cutting down the Christmas tree. She said nothing about leaving the Prairie Cottage in the morning before the phone call from Eddie Cassidy. If this statement is her true belief at the time then it is clear that if Bailey did commit murder Jules Thomas had no idea. Which leads to the next reason.

12 If Bailey did it, Jules Thomas would know

Jules Thomas told Pat Kenny

Don't you think, I mean for a start, don't you think living with someone for seven years, seven weeks after that murder firstly, that there would be a hint? You know, there is such a thing as sort of being mentally connected. I know Eoin didn't do this.

After her interrogation and after she had time to think, Thomas realized that if Bailey had committed this murder, she would have known.

It is telling that even though that once Thomas changed her mind they immediately tried to undermine her credibility. We learned this from the Bandon Tapes. The Detective drawing up the initial report was unhappy at Garda Leahy's opinion in his statements that Thomas was being truthful. Garda Jim Fitzgerald, who wrote Thomas's statement, immediately offered to destroy Leahy's statement, but had to be careful not to offend his partner Leahy. Here is an abridged excerpt from one of the Bandon Tapes

D/Sgt Hogan: Okay, yeah. I need to talk to you about, em, your colleague’s statement of evidence. I need him to...but I’ll talk to you first...

D/Gda Fitzgerald: The most honest man.

D/Sgt Hogan: He has comments in it like “I knew she was making every effort to tell me the truth.” Do you follow?

D/Gda Fitzgerald: Yeah

D/Sgt Hogan: I don't need them for starters

D/Gda Fitzgerald: That statement needs to get fucking chopped up anyway

This is Garda Jim Fitzgerald on tape, offering to destroy evidence, in order to undermine Jules Thomas' credibility. This gives some insight into why no memos exist of the final seven hours of Thomas's interrogation, when she was interrogated by Garda Fitzgerald. This is perhaps the strongest evidence that Bailey is innocent. Jules would know, but even when she had the chance and motive to tell, she did not. The police knew this and said on tape

I tell you now unless we break Jules, who I think must have fucking something for us, we need her broken and we need to have it because if you stand back from it it is a very arguable, it is a 50/50.

This is true, because if Bailey is the murderer, it is inconceivable that Jules knew nothing. The problem for the police is that Thomas was broken during her interrogation. She was told Bailey had admitted it, so she had no incentive to keep anything back from the Gardai and a lot of incentive to tell everything she knew. But if we are to accept her statement then it’s clear Jules Thomas had already given up all she knew. Far from being incriminating of Bailey, this statement actually shows how weak the case was. Even when Jules was persuaded Bailey was guilty, she revealed nothing incriminating.

And if Jules Thomas knew more, then her daughters would know, at this stage you have a widening conspiracy which would be impossible to keep a lid on. Moreover neither Jules Thomas nor her daughters have any incentive to protect Bailey. She ended her relationship and kicked him out over a year ago. Her daughters hate him.

For more on the extraordinary Bandon Tapes see the Fenelly report:

https://www.gov.ie/en/publication/4f26a2-report-of-the-fennelly-commission/

13 The Cyberspace Article

Bailey’s explanation for getting up in the night was that he had to write an article was corroborated by two editors. Bailey was supposed to deliver an article on West Cork Cyberpubs to the Sunday Tribune on Thursday 19th December. This was extended to Friday and on Friday he was given a final deadline of noon on Monday. By Monday they were preparing to put a substitute article in place until, at the very last minute Bailey sent his article through at 5pm on Monday. Needless to say, Monday was an very busy day for Bailey. Bailey had spent the weekend socialising on Friday night, Saturday night through to Sunday morning. He had to kill turkeys and cut down the Christmas tree on Sunday before he went drinking again. It’s hard to explain when he had time to write the 700 word article. If Bailey made up this excuse in the middle of an intense interrogation it is remarkable, because his editors Richard Curran and Tom McEnaney subsequently confirmed it.

Though Bailey did not mention this in earlier statements this is not proof he was lying. During the arrest and detention of 10/02/97 Bailey and Thomas were asked to recall specific details from a night six weeks prior. This is almost impossible to get right. When Bailey remembered he got up, he detailed a very specific reason why. If Bailey made this up on the spot to get out of an incriminating inconsistency, he was able to pluck a remarkably solid excuse out of the air which was corroborated by others.

The article appeared in the Sunday Tribune on 29th December.

14 Sophie's neighbour's dogs were barking when Bailey was in the pub

Anyone who has ever owned a dog knows how sensitive they are to their environment. In separate statements taken only days after the murder, three of Sophie's neighbours reported their dogs were barking from 10pm-2am on Sunday night/Monday morning. David Bray at 12.45 a.m. on 23rd noted that the wolfhound which he minds was unusually upset. Martin Breuininger, said "Between 12m.n. and 2a.m. on 23rd December 1996 my dog kept barking continually. He was standing on the boundary fence around the house." Geraldine Kennedy, another neighbour, stated that her dog was "barking mad from 10.30 p.m. on 22 December and continued this for about three hours practically non-stop". Her husband Derry came home at 01:50 and noted that the dog was barking in the direction of Sophie's house. It was so unusual, he went to check his cattle.

It is very likely these dogs were reacting to the violent disturbance when Sophie was murdered which took place outside within earshot of neighbouring properties.

At this time Bailey was miles away in a pub in Schull.

15 Post Mortem Evidence contradicts Bailey's timeline

The post mortem shows Sophie had a meal within 2-3 hours of her death. Daniel said she was in bed when he called her at 11pm. This means that Sophie must have died no later than 2am.

Bailey was witnessed leaving the Galley Pub at 00:30. He and Jules Thomas drove home and went to bed around 1:30am. According to Jules he stayed in bed for an hour before he got up and she was sure the car did not start that night. Therefore Bailey couldn’t have left the house before 2:30 and couldn’t have been at the cottage before 3:15am, at least an hour after Sophie was already dead.

Another interpretation of the Post Mortem evidence is that she died after breakfast.

For an analysis of the evidence of time of death see this post: https://www.reddit.com/r/MurderAtTheCottage/comments/vml384/was_sophie_killed_in_the_morning/

16 No reliable evidence Bailey and Sophie knew each other

There is no firm evidence that Bailey and STDP knew each other. Alfie Lyons said he was 90% sure he briefly introduced them, but no more than this. Marc McCarthy said he saw Bailey talking to Sophie in September 1995 at the Cape Clear Storytelling festival, but he didn’t make this statement until over 2 years later. He later rowed back saying he remembers a blonde woman, but could have been confused as he had just seen the Crimeline reconstruction. Sophie's agenda shows it is doubtful she went to Cape Clear at all.

Guy Girard said Sophie talked to him of an "Eoin Bailey" but he didn't reveal this until 1999. But he also claimed that the day before she left for Ireland, Sophie read his and Vincent Roget's palms, and then broke down crying in their office before she left saying she was going to die. His colleague Vincent Roget who was present at the time has absolutely no memory of this. He would surely have remembered one of his best friends breaking down saying she was going to die, days before she was actually murdered. Roget said that Girard felt he was on "some kind of a mission", and desperately wanted to help the investigation in any way.

Agnes Thomas said she remembered Sophie telling her was going to meet "a weird poet". Despite making multiple statements to police from 1997 she made no mention of this for 18 years.

These are the very definition of false memories, wish fulfillment. Sophie kept an extensive address book and year planner updated almost every day with meetings, phone numbers, engagements, travel plans etc. Everyone's phone number is there, Alfie Lyons, Leo Bolger, Tomi Ungerer , Hellens, Richardsons, Sullivans of Crookhaven, Bruno Carbonnet etc. Everyone we know she met except Bailey is not there. Bailey also kept notebooks, year planners and diaries and wrote down his thoughts and meetings constantly.

Police in Ireland and France have taken a fine tooth comb to both Bailey’s and Sophie’s diaries, agendas, contact books etc and found no evidence they knew each other.

17 The Long Black Coat

Bailey wore a long black coat on the night of the 22nd. Ariana Boarina accused Bailey of bleaching his black coat on the 23rd, but he was seen wearing it on the morning of 25th. Det Dermot Dwyer accused Bailey of burning it on 26th but he was recorded by another guard wearing it on 31st. Garda Pat Joy seized it from the Studio Cottage on 10/02/97. It was tested for blood and damage. None was found. Somehow the Gardai lost this vital exhibit along with the blood spattered gate. No DNA profiles were obtained from the gate because technology didn't allow this at the time.

18 Means: The accusation is extraordinary, the evidence is absent

For Bailey to perform this murder he would have had to hike over an hour to Dreenane, bludgeon to death a person who he barely knew, if at all, in a violent and exhausting assault using heavy objects in the dark. Then he supposedly hiked back via Kealfadda bridge (1.5 hours) which is a total of 12km hiking in the dark walking away from an incredibly bloody crime scene and yet left no evidence whatsoever at the scene or at his home or the car or his clothes etc. He also managed to get up the next morning and work a very busy day talking to multiple journalists, Gardai and others filing copy to the Sunday Tribune and the Daily Star. He somehow managed keep the murder secret from Jules Thomas and everyone else who came to the Prairie Cottage that Christmas.

To make an accusation that extraordinary requires credible evidence that is equally extraordinary. Such evidence as there is, is little more than hearsay and conjecture. He-said/she-said nonsense and rumour. You cannot convict on this basis.

19 Motive: There is no known motive.

No evidence of sexual assault was found. Almost every blow was aimed at her head. Criminologists who have examined the photos agree that this suggests a personal attack. There are problems with all the various motives attributed to Bailey including: – rage killing due to rejected sexual advances – there no evidence sexual assault and why was the victim outside? Another motive is that Bailey killed her "for a story", i.e. to boost his career as a journalist. This is a bizarre motive, it is hardly a way to get rich. It doesn’t fit what we know about the crime scene. A murder for profit implies a plan which is at odds with what seems to be an unplanned rage-filled frenzy. A killer who merely wished to create a murder mystery would surely find an easier and simpler method. It is also worth pointing out, that by writing about the murder, Bailey completely destroyed his career, and his career was already recovering at this time. He had several stories published in the Southern Star and others in train with the Sunday Tribune at this point.

20 Opportunity: Hunt's Hill

Bailey allegedly saw a light on at Sophie's house when he stopped at Hunt's Hill driving home from the pub, mentioning a "Party at Alfies". These details only appeared until Jules Thomas's dodgy statement which she denied immediately afterwards. Lyons and Foster, a couple in their 60s, said they went to bed at 9:30pm. There was no party at Lyons'.

Nevertheless this detail is essential for the Gardai to demonstrate criminal opportunity. Otherwise, why would Bailey hike 4 km in the pitch dark over to a house where a woman was asleep? I've been to Hunt's Hill, you can't see Sophie's house or Alfie Lyons's from Hunt's Hill unless you have a telescope, its 4 km away. That is in daylight. At nighttime it's impossible. In 1996, Sophie's house did not have a light on the eastern gable. She had a light over her back door, but this faces west and is not visible.

21 Gardai were incompetent, engaged in farcical and corrupt practices to try to convict Bailey

The Gardai management of the crime scene was unbelievable. Vital forensic evidence must have been lost. Many basic tests were not even considered. They ignored Harbison's instruction to take the body from the scene and left it outside for 24 hours. Exhibits were lost.

The Gardai leaked an extraordinary amount of information to the press and locals.

They cultivated bizarre relationships with certain witnesses. The Gardai gave drugs to Martin Graham to get him to induce Bailey to confess. They surveilled Bailey for months without success. When they realized they were being played they then tried to turn it around to discredit Graham, taping themselves in the process discussing drugs with him. Throughout the country including Bandon the Gardai were running in a massive illegal wire-tapping system. In the process they forgot they were bugging themselves. So they were caught on discussing the suppression of evidence and tampering with witness testimony. When they found out that their suspect was talking to their main witness, instead of immediately shutting this down they tried to wiretap the meeting in a farce worthy of Inspector Clouseau.

For more on Garda corruption and the drugs episode, see this post: https://www.reddit.com/r/MurderAtTheCottage/comments/uldu3m/the_martin_graham_episode_or_how_the_gardai_tried/

22 Conclusion - Bailey is innocent

I am a supporter of our adversarial, evidence-based legal system. I am not a supporter or defender of Bailey. As far as I am concerned, he should have been incarcerated for his violent assaults on Jules Thomas. He is a narcissist, attention seeking alcoholic. But being an attention seeker, he has garnered all the attention in this case, such that the Gardai dropped all other lines of inquiry until it was too late, and other leads were forgotten. I have been down every rabbit hole and every supposedly damning piece of evidence falls apart when you look at it closely. After years of analysis, when I step back I cannot view Bailey as a good suspect for this crime. I don't believe he is a criminal mastermind or freakishly lucky to leave no evidence.

The Gardai expended huge resources trying to convict Bailey getting nowhere in 26 years. Since the Gardai and DPP gave up, the tabloids and true crime writers have discovered that Bailey is a reliable generator of curiosity and outrage, and outrage is worth money. There is a profitable cottage industry of books, podcast and documentaries recycling accusations against Bailey.

After 25 years of investigation, the reason why no convincing evidence has been found on Bailey is that it just isn't there. It is time to accept that Jules Thomas is telling the truth. Despite having been assaulted violently several times by Bailey and having ended their relationship Thomas still doesn’t believe he is the murderer.

It doesn’t matter however odious a person Bailey is. It doesn’t matter what weird poetry or porn he has written, or if he really does howl at the moon. If we cannot make the evidence fit he is innocent of murder.

The evidence for a killing at dawn

There are certain pieces of the evidence that suggests Sophie may have been killed at dawn, shortly before or after sunrise on the 23rd. I have collected these indications here.

Condition of the body

When the body was found three first responders commented on the fact that the blood on her face was different or appeared to be fresh:

Garda Prendiville (arrived at 10:38am)

“Her hair was covered with blood as was her face, however, I observed that the area around the nostrils appeared wet as distinct from dried blood.” (Statement made 27/12/1996)

Garda Byrne (arrived at 10:38am)

“There was a lot of blood which appeared to be fresh on the face, neck and hair.” (Statement made 27/12/1996)

Dr Larry O’Connor (arrived around 11am)

“Her nose and nostrils were covered in bloodstaining which to me appeared lighter in colour than the rest of the blood staining.” (Statement made 26/12/1996)

The weather on the morning of the 23rd was dry, partly sunny with a fresh to strong easterly breeze. Photos and news video from the crime scene seem to grasses and bushes flapping in the breeze. There was no rain recorded in Schull on the night of the 22nd. Temperature overnight was around between -2C and 2C, but probably did not go lower than zero, as this area of Ireland has the mildest climate in the country, frosts are rare. Such weather would be expected to dry out wet blood quickly.

Stomach Contents

State Pathologist John Harbison wrote:

“The stomach contained a recently ingested meal apparently mostly fruit including yellow skins and possibly nuts*.”*

“The trachea contained a mixture of a small amount of blood with food particles.”

There were foodstuffs found in the kitchen which possibly match the stomach contents.

The “yellow skins” matches the basket of oranges, clementines and apples which is visible under the table on which the bread board is placed. There is a bag of "Jordan’s Crunchy" breakfast cereal is on the shelf above the sink and this is a possible explanation of the nuts.

Harbison commented that she would have died within two to three hours of ingesting that meal.

This yields two possible time-windows during which death may have occurred. Sophie was already in bed according to Daniel who spoke to her on the phone. The call was made at 11pm so we can assume she finished eating at the latest around 10:30, giving a time of death between 12:30 & 1:30. The second possible time death could have been anytime from 7am-10:00am.

Her husband Daniel said that her habit was to have a glass of wine with cheese. There were partly consumed cheeses covered with glass on top of the fridge in the pantry and a stoppered half consumed bottle of red wine, which matches Daniel’s observations. The half full bottle of wine in the pantry indicates about 3 glasses have been drunk. This would allow a single glass of wine each night of her stay, Friday 20th, Saturday 21st and Sunday 22nd. This would also match the 2 empty glasses on the draining board and one with dregs on the mantlepiece. One glass per night.

It doesn’t make sense, especially for a French person, to eat fruit like oranges together with wine and cheese.

No alcohol detected in blood or urine

According to her friend Tomi Ungerer, Sophie had two glasses of wine with him but refused a third and left his house at 5:45pm. It is also suspected she had at least one glass of wine at home in the evening. A wine glass with dregs of red wine was found on the mantlepiece above the fire which was lit the night before the murder. However there was no alcohol detected in her system, either in her blood or urine. Arguably, alcohol in her bloodstream could have been all metabolized, however alcohol is detectable in urine for much longer than in blood. If she consumed one or more units of wine before bedtime and died no more than 2-3 hours afterwards alcohol should be detected in urine. Typically a drugs screen can detect alcohol in urine 12-48 hours after drinking.

Food items in the kitchen and pantry

The victim left a number of items which tend to suggest breakfast rather than an evening meal.

First there is the open loaf of white bread which was being sliced. The is a kind of crusty white loaf with a distinctive swirling shape known as "basket loaf". It is often sold wrapped in brown paper and we can see this paper is unfurled. It is soft white bread and goes stale quickly if left in the open. The breadboard has a slot for storage of the breadknife. In the photos, the knife is on the board, a portion of the bread has been sliced and presumably consumed. There are crumbs on the board from previous slices. The bread is left open to the air and the knife is left ready to be used to cut another slice. There is an open bread-bin on the wooden dresser across the kitchen from the breadboard. It is likely bread was kept there to maintain its freshness and taken out when it was needed.

Note that the cheese and wine have been put away properly in the pantry. French people know it is better to keep cheese close to room temperature for optimum taste. Therefore it was left on top of the fridge covered by a dome. Similarly if you are to drink a bottle of red wine over several days, you have to stopper it to prevent oxidation. She may have had a glass of wine with cheese, then put both away afterwards.

Now contrast this with the bread which has been left to go stale in the open. These pictures suggest that had she not been interrupted she would have rewrapped the bread and replaced it in the breadbin.

The assault would have been difficult in the dark

If there were no lights, a chase and assault in the middle of the night in the outside would have been difficult. If Sophie was running for her life it would be difficult to catch her, especially if her killer was drunken.

The blows that were made, were almost all against her head and were accurately aimed.

Finally, the killer used a concrete block from the pumphouse to deliver a final blow to the victim. It took considerable effort to obtain this block. The block could not merely been picked up from the pumphouse, it required lifting and breaking the wooden and asphalt felt "lid", moving the outside corner block and then retrieving the desired block. Moreover it required that the killer either knew or saw that the block was loose and not cemented in place. He needed enough light to accomplish all this. Doing this in the dark, even using the light of the moon would have been difficult. If there were clouds then I would argue it would have been impossible.

The house lights

All the lights in the house were off when the Gardai checked the house. In her statement made 24th December Shirley Foster wrote:

Before I went up to bed on Sunday night at about 9 p.m., I pulled back the curtain and I saw the light on the gable end by the back door was lighting. That would be normal for her to have that light on.

There are three possibilities;

1. The victim turned off the gable light before bed and at the time of the assault she exited the house in the dark without turning on any lights.

2. The killer extinguished the lights in the house during or after the assault which caused her death

3. The lights were off because it was already bright enough to come downstairs and make breakfast. The victim was killed shortly after breakfast. This would put the time of death no earlier than 8:30.

Scenario (1): Night. She went outside in the dark without turning on any houselights. This seems unlikely. At minimum, most people would turn on lights to avoid falling on the stairs or over furniture. Coming from the guest bedroom, there is a stairs, shoes, chairs, tables, bags and doors to negotiate in order to reach either the front or back doors. She also put on her hiking boots, which were either at the bottom of the stairs or by the front or back doors. To do all this without turning on any lights would not be impossible but it would be very awkward. You might do this if you were afraid, and wanted to sneak around the house without being seen but if she was afraid she should have called someone on the portable telephone which was right beside her bed. Perhaps she was afraid at first and then opened the door to someone familiar? In this case it would also be normal to turn on the light before opening the door, at least to verify who it was. Both the front and back doors allow a person opening the door to look out a window to see who is there.

Scenario (2): Night. The killer extinguished the lights afterwards. This is possible, but it seems strange to imagine a killer performing an extremely brutal and apparently rage-filled murder, leaving a chaotic and messy crime scene but then manages to coolly enter and leave the house leaving no blood marks inside. The killer would have had blood on his hands, clothes etc. There is a blood mark on the door but none were recorded inside the house, which may indicate that whoever made that mark, be it the victim or the killer, did not enter the house in via this route during or after the assault.

Scenario (3) Dawn. The lights were off because it was already light outside. In Toormore, on 23rd December 1996, dawn would have occurred at 8:04 am and sunrise at 08:44. Whether it was light enough to move around the house without turning lights on depends on cloud cover, individual preference etc, but it seems reasonable to say that in this scenario she could see well enough to move around without falling over the furniture by 8:15. It is also possible she had the light on and then turned it off when the sun rose. Allowing some time for breakfast and for the assault then we could posit a time of death around 8:30am at the earliest, 9:30am at the latest.

So that's it. Of course none of this is 100% certain, we can individually argue against each piece. It is possible the blood and urine samples were mishandled, or the tests were relatively insensitive or even botched, maybe she didn't care to put the bread away, maybe she ate oranges and biscuits before bed and maybe wet blood can survive drying overnight in a cold wind.

To my mind, though, in the balance of probabilities, she died in the morning.

Extract from Michael Sheridan article in today’s Times:

“A forensic breakthrough in the 29-year-old murder of Sophie Toscan du Plantier could bring the case to a conclusion as early as next month after the discovery of significant DNA evidence during a cold-case review.

For the first time since the French film producer was found brutally murdered in west Cork in December 1996, investigators have identified potentially conclusive genetic material using cutting-edge forensic methods.

• DNA experts visit west Cork to solve Toscan du Plantier cold case

The breakthrough comes after a three-year re-examination of the case, which has long gripped public attention and resisted resolution despite extensive investigations in Ireland and France.

The DNA material, believed to have come from the killer, was recovered last month using a forensic technique known as Touch DNA and a device called the M-Vac — a high-powered forensic vacuum brought to Ireland from Utah by the company’s chief executive, Jared Bradley.”

Can we all just take a moment to appreciate how completely disruptive this absolute wagon has been to the entire case?

1 Introduction

The Serious Crime Review Team (aka Cold Case Unit) has just begun a review of the murder of Sophie Toscan du Plantier in 1996. This article is an overview of the forensic tests performed to date at the scene of the and exhibits, with an in-depth focus on the DNA tests. In 2011 a French lab found an unknown male DNA profile on the body of the victim. Here I will describe this profile and show how it does not match Ian Bailey. To date this remains the only piece of evidence linking another person to the crime scene and it is essential that the Serious Crime Review Team review this evidence and repeat DNA testing on this item and other exhibits.

1.1 Background: How does DNA fingerprinting work?

We have 6.4x10⁹ base pairs of DNA in our genome, one half inherited from each parent. Each base pair, consists of a pair of amino acids, and there are only four combinations,(Adenine, Cytosine, Guanil, Thymine shortened to A, C, G and T). Inside the cells there are mechanisms which read this script and use it to build all the different structures within. Typically these base pairs are grouped in threes and each triplet encodes a different protein. Stringing them together builds structures which build cells and do just about everything to make a body function.

However not all the DNA is grouped in threes. It was discovered that in some places there are repeating sections. What these repeating sections do is still the subject of research, but are very useful in applications to forensic identification.

For example:

• CTAGAGATAGATAGATAGATAGATAGATACTAGACTAGACTAG

Has the sequence GATA repeated six times

In the 1990s it was discovered that some these repeating sequences mutate quickly and therefore vary a lot between individuals. These are called STRS or Short Tandem Repeats, also sometimes called “microsatellites”.

For example:

• Person A: CTAGAGATCGATAGATAGATAGATAGATACTAGACTAGACTAG

• Person B: CTAGAGATCGATAGATAGATAGATAGATAGATAACTAGACTAG

• Person C: CTAGAGATCGATAGATAGATACTAGACTAGACTAGTCAGAGTC

Person A has 5 repeats, person B has 6 and person C has 3.

But there is an additional complication and source of variation. Because everyone has two parents, there are two copies of the genome, with different numbers of repeats inherited from the mother and the father.

• Person A: CTAGAGATCGATAGATAGATAGATAGATACTAGACTAGACTAG 5

• Person A: CTAGAGATCGATAGATAGATAGATAGATAGATAGATAGACTAG 7

• Person B: CTAGAGATCGATAGATAGATAGATAGATAGATACTAGACTAGA 5

• Person B: CTAGAGATCGATAGATAGATAGATAGATAGATACTAGACTAGA 5

• Person C: CTAGAGATCGATAGATAGATACTAGACTAGACTAGTCAGAGTC 3

• Person C: CTAGAGATCGATAGATAGATAGATACTAGACTAGACTAGTCAG 4

So for this STR person A has 5,7, Person B has 5, 5 and Person C has 3, 4

A single STR is no use to identify a person, because by random chance you will share that STR number with many people. However, when you combine a lots of STRS, the probability declines until it is possible to generate a unique genetic “fingerprint” or profile and is represented as list of numbers on each site. The calculation of this probability is complex and relies on knowing the frequency of STR variants within the population. Regardless, the STRs have been chosen in such a way to ensure that a complete profile has a uniqueness guaranteeing that the probability of a random match from an unrelated person is typically 1 in 10¹⁶ . As This is a number greater than the number of humans who have ever lived, we can be confident a complete profile will be unique to the individual it is taken from.

As DNA science progressed more and more genes, and more STR sites were found.

They were all given names which mean little except to geneticists. To make it easier those names are contracted into acronyms, so the STRS have names like F13A1, TPOX, THO1, VWA31A etc. It’s not necessary to understand the names or what the genes do.

Typically at least 10 STRs are required for a genetic profile which can be said to be unique. The FBI DNA database consists of genetic profiles using 13 STRs.

2 Forensic testing on the body, the exhibits and crime scene

The scene was preserved from 10:38 on 23/12/1996, although there has been criticism of the Gardai handling of the site. It has also been claimed that bad weather and rain washed away vital evidence. Weather reports at the time show that it was cold, but there was no rain recorded in any of the local weather stations or at Cork Airport on the night of the 22nd or 23rd . There was fresh to moderate wind from the East and temperatures were low enough (-2 to +2 Celsius) that there may have been a light frost in the morning. In short the weather was cold and dry, which is as good as it could have been with respect to preservation of evidence.

Initial photos were taken by Det. Garda Pat Joy who arrived at 12:05. The body and immediate area by the gate was covered in a sheet of plastic from about 1pm. The forensic team arrived at 10:10pm according to retired Garda technician Eugene Gilligan. The pathologist, John Harbison arrived around 10am on the 24th. Therefore the body was lying outside approximately 25 hours after discovery and not 30 as is often asserted. The extremities of the body were covered in plastic backs and the body was taken the Cork Regional Hospital (now CUH). This journey would have taken 2 hours (2 hours) and there would have been possible stops for lunch on the way and whatever other preparations were required. Traffic delays would have been inevitable, given the fact that it was Christmas Eve. The post-mortem examination began at 1:57pm.

Swabs were taken from body intimate areas, scrapings from under the fingernails of both hands and hairs were collected from her hands.

A number of exhibits were taken from the crime scene in 1996 and from the principle suspect on his arrest on 10/02/1997:

• From the victim herself, they took her clothes, swabs from her body, samples of hair and blood.

• From the scene they took the concrete block, slate rock, a small pebble, briars, the door handle, the farm gate and soil samples.

• From the cottage they took papers, diaries, jewelry, bags and a table from the kitchen

• From the suspect they took clothes, footwear, hair and blood samples

• From the Prairie Cottage the took clothes including a several jackets, pairs of jeans, shirts, a waistcoat, a multi-coloured scarf and a black hat

• From the Studio they took a long dark overcoat (PJ24) and a Poetry Ireland competition entry form which held a human hair.

2.1 Boot Print Analysis

Boot prints were found at the scene. These were photographed and measured. An attempt to plaster cast the print failed. Footwear was taken from various suspects in an attempt to match against these prints. According to Garda Eugene Gilligan only an approximate shoe size could be calculated.

2.2 Fingerprint analysis

Note a "fingermark" is a mark made by a finger. A "fingerprint" is a fingermark which has been identified.

A Garda technical analyst carried out a detailed examination of the house and exhibits in the days following the murder. No identifiable fingermarks were developed from the gate. The wine glasses in the kitchen were clean and no marks developed. There was a third wine glass which contained some red wine located on the mantlepiece above the fireplace in the living room. On powdering this glass, fingermarks developed. These were eliminated as having been made by the deceased. Marks were found in the house were identified as belonging to the victims housekeeper and family. Some marks were never identified.

A wine bottle was discovered by John Hellen in April 1997. This was tested, but no fingermarks were found.

2.3 Blood Group Tests

A civilian forensic scientist at the Forensic Science Laboratory, Phoenix Park, Dublin performed the first set of forensic tests on the exhibits including clothes, concrete block etc taken from the scene. She did not do DNA analysis, but performed blood group tests. As Ian Bailey and Sophie Toscan du Plantier have different blood groups then it was therefore possible to discriminate between them, but not from any third suspect who shared blood group with du Plantier. It was a sufficient test to eliminate blood stains on many items taken from the suspect’s house.

She grouped blood on the slate rock and other items including scrapings from under the fingernails and found it matched Sophie Toscan du Plantier. No semen was detected on the vaginal, anal, rectal, vulval, mouth or thigh swabs. No seminal staining was found on the top or legging bottoms.

She was unable to obtain blood grouping from the concrete block, nor from the blood drops on the boots.

No seminal staining was found on the bedsheets, mattress or mattress cover. She found a light smear of human bloodstaining on the bedsheet which was too small to sample.

When it came to the clothing, she performed blood group analysis on blood stains where she found them. She found a bloodstains on several items of Bailey’s clothing including shirts, jeans and a jacket. She found the group to be consistent with his own. She also found bloodstaining on a beige jacket but the samples were too small for her to obtain blood group information so instead she cut portions of the fabric and sent them to the Forensic Science Laboratory in Northern Ireland for PCR DNA analysis. She did the same with some other items of Bailey’s clothes which had apparent blood staining including jeans, a rugby shirt and a jacket.

Amongst the items also taken from the Prairie Cottage and tested were a waistcoat and a scarf. Note that in the testimony of Richard Tisdall and Bernadette Kelly, Ian Bailey was observed in the Galley Pub on the night of 22/12/1996 and was wearing a long dark coat, a waistcoat and a multi-coloured scarf. No blood or damage was found on these items so and she did not send them for further testing.

The hairs taken from the hands of the victim were found to match her own. The hair taken from the Studio house did not match the victim.

2.4 The long black coat (Item PJ24)

Detective Garda Pat Joy recorded taking a “black overcoat” from the sofa of the Studio House on 10/02/1997. It is also listed as “black/dark navy overcoat” in the exhibits list.

The Garda forensic scientist examined exhibit PJ24 but did not find any evidence on blood or damage on it consequently this item was not sent for DNA testing.

As noted in the GSOC report item PJ24 is missing.

Bailey was seen wearing a coat matching this description on the night of the murder in the Galley Pub, on the 25th at the Christmas Day swim and on 31st December.

Garda Martin Malone said Bailey was wearing this coat when he approached the crime scene on the afternoon of the 24th at 14:20. A photograph taken later that day shows Bailey wearing a reddish brown three-quarter length jacket.

3 DNA Tests

DNA testing has been done three times in 1997, 2002 & 2011.

3.1 DNA Testing in Northern Ireland 1997

The first testing was done by a scientist in Northern Ireland and his results are detailed in a statement on 28/07/1997. Only 4 STRS were recorded but the profile is listed in his statement, and we have these 4 STR values for both Sophie Toscan du Plantier and for Ian Bailey. Such a small number of STR sites would not be sufficient to identify a person in a trial though you can exclude someone on the basis of one or more differences in STR. So even with few STRS you can be certain someone doesn’t match, if their respective numbers are different.

The scientist tested mainly items of Bailey’s clothes, including a beige overcoat, though not the long black coat PJ24 because no blood was detected on it. The scientist did not detect the victim’s profile on any of the samples he took, including the sample from the back door. He detected a third profile which didn't belong to either the suspect or the victim on the beige overcoat.

3.2 DNA Testing in Yorkshire 2002

The second testing was done by a scientist in the Forensic Science Laboratory in Wetherby, Yorkshire, UK.

She used 11 STRS, and unfortunately the file does not record the profiles she generated, only her conclusions. She tested only two exhibits, the first was a blood flake (EG9) taken from the back door handle at the house. This time she had more success than the tests in Northern Ireland. She was able to generate a partial DNA profile from a blood flake taken from the door handle. Although this was a partial profile, she said the result provides “very strong support” for the assertion that the blood flake came from Sophie Toscan du Plantier.

The second test was blood found on the vegetation at the scene. She checked 6 areas of vegetation “selected to avoid obvious bloodstaining”. 5 of these yielded a profile matching Sophie Toscan du Plantier. The 6th gave no result.

3.3 DNA Testing in France 2011

The third tests, and as far as we know, the final DNA testing, were done by French scientists, at the Institut National de Police Scientifique in Paris. These were by far the most extensive tests done. They tested over 100 different locations on items taken from the crime scene including the victim’s clothes, the concrete block, the slate block, a small stone & fingernail scrapings. They did no tests on clothes from Ian Bailey, the blood flake from the door handle or on the blood samples taken from Ian Bailey and Sophie Toscan du Plantier. This is because these exhibits were not available. The coat (PJ24) was missing at this stage, and both the blood flakes and blood samples had been entirely used up in prior DNA testing.

The exhibits themselves never left Ireland. Instead a French scientist took swabs from the exhibits stored in Bantry, and brought those swabs back to Paris for testing. She noted that the exhibit bags were not sealed shut.

Not every location was tested for DNA, and not every location which was tested for DNA was tested for blood. Two DNA profiles were found, which they denoted F1 & M1.

3.3.1 Female Profile F1

This profile was found extensively on all the exhibits tested. It clearly belongs to the victim. There are three STRs in common with the testing done in Northern Ireland and these three match Sophie Toscan du Plantier. The scrapings from under fingernails from both left and right hands produced partial profiles consistent with profile F1.

3.3.2 Male Profile M1

The male profile was taken from the left boot (PJ10) site P3. She described it as “une trace blanchâtre” - whitish trace taken from “à la base de la patte sur le dessus de la chaussure gauche” at the base of the tab on the top of the left boot. An accompanying photo shows where P3 was located.

The reports says that this site was not tested for blood. Perhaps this is because it did not look like blood.

The photos from the autopsy included one photo of her boots.

Site P3 is indicated by a red circle. We can indeed see a whitish substance in this area, and it is possible that this is what caught the scientists eye and prompted her to choose this area to test.

3.4 Combined DNA Results

Although the French tests did not have the blood samples to test, we can combine the results of the Northern Ireland tests with the French one.

Between the two tests two of the STRs were only tested in Northern Ireland, and 13 STRS were only tested in France. However two STRs were sampled in both tests, STR sites THO1 & VWA31A.

We can therefore compare these STRS between the two sets of tests to make the following conclusions:

The female sample found in the French tests corresponds exactly with the testing done by Cosgrove, so this profile must be that of Sophie Toscan du Plantier.

The male sample does not correspond either to Sophie Toscan du Plantier blood sample (also differing in sex chromosomes) and does not correspond to the STRS from the Bailey blood sample. Therefore this is a third person. As the French tests included sex chromosome testing, this profile is male.

These two STR sites do not match those obtained in the NI tests from Bailey’s blood sample,

Therefore this male sample does not belong to Ian Bailey.

3.4.1 Summary Table

The details are shown in table form below.

For brevity only 7 exhibits are shown. Many other items were tested with the same results. In particular the French tests got dozens of profiles corresponding to the victim from her bathrobe, tee shirt, the small stone with a blood drop on it. Only 1 profile was different from all the others, that is the one taken from PJ10, site P3, at the base of the laces on the left boot.

• Exhibit GOD1 is Sophie Toscan du Plantier’s blood sample

• Exhibit GOD2 is Bailey’s blood samples.

(These samples were only tested in the Northern Ireland Forensic Lab, hence there are only 4 STRs, FES/FPS, F13A1, THO1 & VWA31. The Northern Ireland tests also omitted sex chromosome tests)

• Exhibit GOD9 is the upper right leg of Bailey’s jeans which bore a blood stain

• Exhibit GOD12 is a rugby shirt belonging to Bailey which bore a blood stain on the collar

• Exhibit EG3 is the large flat stone found next to the body.

• Exhibit PJ12 are the legging the victim was wearing

• Exhibit PJ10 is the victims boots, only the left boot was tested.

From this table it can be seen that there are two STRS that are in common between both sets of tests, THO1 & VWA31.

When we compare the sample from PJ10 with the blood samples of the victims and Ian Bailey, the sample tested from exhibit PJ10 does not match either GOD1 or GOD2 consequently it belongs to a third person. The sample tested as male. Therefore this profile came from a third person, a male who was not Ian Bailey.

4 Other potential sources of sample M1

In addition to being a potential sample from the killer, the male DNA profile M1 could belong to a number of other people.

The most likely source of contamination is John Harbison. He recorded in the port-mortem report “I pulled off the left boot without untying its somewhat strangely located bow knot. The bow was located on the outer side between the lst and 2nd lace holes”. This strange knot looks to be present because at some point the lace of the hiking boot has snapped and the shorter lace was tied down at a lower eyelet. Also note that Tomi Ungerer said the victim was wearing a pair of suede hiking boots when he met her on Sunday 22/12/1996.

So he is known to have touched the boot. Harbison was wearing surgical gloves. Other candidates include the port-mortem technician, the five Gardai present at the autopsy and the undertaker and his assistant who removed the body.

4.1 Testing for contamination and familial matching

It would be a straightforward matter to test the people who are still living. However, a number of the participants are now deceased, including John Harbison. If his DNA sample is not on file, it would still be possible to check his living relatives. Because of the laws of inheritance, we would expect a sibling, parent or offspring to share 50 % of a person’s genome and therefore would match at least half of each STR. At time of writing Harbison has a living brother (Peter) and two children. If profiles taken from these individuals showed a 50% match we would strongly suspect John Harbison as the source of the DNA profile.

The same technique can be applied to other deceased investigators or deceased suspects to screen them out. A 50% match found on a person would not be sufficient to charge a suspect, but would warrant further investigation.

There is no indication in the file that the DNA profile has been compared to anyone.

4.2 Profile M1 could not have come from Pierre Louis Baudey, Bertrand, Stefane or George Bouniol

In the table above, the familial match for du Plantier is shown. For example site CSF1P0 (among others) is recorded as 10/12 in both samples. Site DS13S317 is recorded as 8/8 in the du Plantier sample, but 8/11 in M1. This would be a 50% match and if this was repeated across the 15 STRS we could suspect that the sample came from an immediate relative However as 7 sites do not have any repeats in common we can eliminate Sophie’s father, brothers and son as potential sources of this profile.

5 Conclusions

The male DNA profile M1 found on the victim's boot did not belong to Ian Bailey or any of Sophie’s close blood relatives. As this is the only forensic evidence of a third person at the scene, this profile warrants further investigation, at a minimum it should be retested to see if it can be repeated and checked it is contamination from investigators. If this site were retested, a much more extensive profile could possibly be generated, allowing familial DNA matching. Such techniques can find matches up to 3rd cousins.

Even using the current profile it would be possible to check for contamination from investigators through a combination of testing those investigators still alive and testing their immediate relatives. It would similarly be possible to test this profile against potential male suspects and their close relatives.

The fact that the exhibits including the concrete block produced many valid DNA profiles, investigators should retest the exhibits with modern techniques. In principle the concrete block has potential for DNA from the culprit. The block was taken from the pumphouse and the roof or lid was removed to do this. The roof was constructed with wood covered in roofing felt. The timber frame was destroyed when the block was removed and this act carried a high risk of hand injury, because of the row of nails used to affix the roofing felt.

French scientists in 2011 tested over 15 locations on the faces, edges and orifices of this block. The hope of finding new profiles has to be set against the extensive nature of the French tests in 2011 and the time which has passed.

Apparently he is dead now, but he had a strange relationship with Sophie.

Its crazy to me that he has been overlooked in this investigation, as to me he is a more likely suspect than Ian. He is confirmed to have definitely known Sophie and there are rumours of some bad-blood between them (talk of a dispute over land and horses, and someone was using Sophies bath who was believed to be Alfie).

Alfie was allegedly home that night and says he did not hear anything, but given the nature of the crime it would be strange is Sophie was not screaming.

One thing that struck me is that Sophie was running away from the Lyons house instead of towards it, which seems crazy. Even if you were not on good terms with your neighbour, if you were being attacked your instinct would be to go to seek help and refuse from other humans, unless you were running away from your neighbour.....

Thoughts?

Can’t stop thinking about the neck on Marie Farrell to walk into a Garda station a few weeks back and give a new statement, saying the man she saw was an associate of Sophie’s husband. The scene and context of her giving a new statement is absolutely ridiculous. Love to know what was going through the head of the Garda that took it down 🤡🤥

The damage she has done this case from 1996 to date is criminal.

Again and again she lies and lies. Why no repercussions?

A number of things bother me about this case. The fact that the Gardai narrowed their focus so early on to IB was both lazy and opportunistic. It’s clear IB has a personality disorder (possibly borderline) which most people don’t seem to realise is not a choice and was evident to me especially in the way Jules defended him whilst obviously exasperated by his behaviour. Just as some people have very agreeable or neurotic personality traits it is not a choice & can cause problems in relationships with other people. It is, in fact, easier to treat a psychiatric condition than a personality disorder as those afflicted can function normally but in the end alienate everyone by seemingly being incapable of learning from past experiences. Alcohol or drugs are often used to self medicate the condition, where, perhaps, proper diagnoses & self acceptance is more useful. However, BPD, despite unusual behaviour makes someone an easy target to accuse, not a murderer. There were so many other lines of enquiry. No. 1 Alfie Lyons. Not wanting to speak ill of the dead but it’s documented there were issues between him and Sophie regarding land, particularly their joint entrance (gate) ,the very place Sophie’s body was found. Neither he, nor his partner heard any disturbance despite living very close by. Sophie’s housekeeper seemed to believe it was Alfie taking a bath in her house when she wasn’t there. If so, he certainly knew the layout of the house. This is a very, very odd thing to do, smacks of a certain anger, jealousy, possessiveness. How did he get in? Did he have keys cut somehow? Also IB is supposed to have stood outside the pub on the night before she was murdered and said there was a party going on at Alfies. Was there? If so, who was there? No. 2 The blue Ford car seen by a named witness speeding out of the road from Sophie’s house at 7.00 am on the morning she was murdered. She was found at 10.00 am by Alfie’s partner. Didn’t anyone find it odd that Sophie also had rented a blue Ford Fiesta on arrival in Ireland. I know there’s a theory that a well known Garda (since deceased) drove a blue Ford but that aside (albeit important), could it have been Sophie’s car dropping someone off after the event and returning the car within the 3 hours before she was found? Was her car examined at all? Also, did the Gardai check whether any other blue Ford was rented at Cork airport that week and if so, when was it returned? Is it possible now to get those records? No. 3 Why was Sophie there? Obviously, she loved the place. It seems to me to have been a solace to her from the days she came to Ireland to learn English as a teen. She could be private there (although not quite as much as she thought given the issues with the neighbours) & brought her friends, family (I think) & lover (Bruno) there to unwind, recalibrate, think, read, walk, who knows, her own business anyway. However, her Mum and Dad seemed to think she went to fix the heating? Is there any physical evidence the heating was awry? Surely, she could have organised with the housekeeper to have an experienced plumber come and do that by phone. Whatever, this is the only reason we’ve been told she came. Did she talk to her housekeeper/a plumber when she was there? Two chairs were situated near the radiator, it must have been working. Her Mum said she often put her feet up on a chair whilst reading, it doesn’t indicate anyone else was there.

No. 4 If the petrol pump attendant was right in identifying Sophie & a passenger in a blue Ford Fiesta stopping for petrol at his station is true, who was the male passenger who paid him? No. 5 Lots of people on this thread diss Marie Farrell as an unreliable witness because she changed her story from full ID of IB as the man she saw on the bridge the night Sophie was murdered to it being a complete fabrication to fall in line with Garda pressure. Context is so important here (as it almost always is). She was a married woman in 1996 and had lied to her husband to go out and meet an old boyfriend that she had met earlier in the day. She told her husband she was going out with “the girls”, it being Christmas. Whether they ate, drank & chatted that night, or whatever is nobodies business. She obviously didn’t want her husband to know and for sure, the Gardai knew that. So, she went along with their focus which was IB. But, who was the man she saw outside her shop when Sophie went in to buy the paper ? Was it the same man the petrol pump attendant saw in the car that day? Has there ever been a proper attempt to ID him?

No. 6 Obviously, the German musician whose wife had left and gone back home, topping himself approx 6 weeks after Sophie’s death & saying he’d done “something really bad” to a friend has to be a contender. Sophie’s friend in France said, at the French trial that Sophie had had some communication with a guy that wanted to share poetry with her (implicating IB who writes poetry). Maybe, it’s possible that the german guy (a musician but maybe dabbled in poetry) wasn’t admitting to a murder before he took his life but that he had set something up that led to it. I’ve never seen a picture of him but surely the Gardai needed to rule him out.

No. 7 The manner of Sophie’s death suggests to me that there was more than one person involved, if not in the execution of it, certainly in the knowledge. It happened completely outside her house. This was not a simple or even passionate rage but a determination that she would die (concrete block). I feel (& it’s only a gut feeling) that it happened in the early morning rather than the night. I don’t believe there is only one person (her murderer) who knows about this. Far too many questions scream out at you that there was a joint effort going on here (be it Alfie & the senior Garda over some deal cut around growing weed) or some French/Irish/German collaboration around something domestic or deeply intimate/personal. Her parents are so gentle it seems intrusive & unkind to question the real reason she was here in 1996 but it is important to ask that in order to find out why this beautiful young woman came to such a vicious & absolute end. There are so many lines of enquiry that should have been followed back in 1996/97,but, we are where we are, and whatever evidence is left should be forensically followed. In fairness, as an Irish woman, I see both IB and STDP as guests of the nation, one dead in horrific circumstances, the other left hanging but alive for 27 yrs in West Cork. I’m not saying it wasn’t IB or the Gardai covering for one of their own or, indeed some French connection, but until there is a forensic examination of the unidentified cars/men mentioned above it’s very hard to be 100% sure. Thanks for reading, I know it’s been long.

The last man to speak with Sophie Toscan du Plantier has died.

Publican Billy O’Sullivan, 88, spoke to the French artist the night before she was killed in 1996, when she visited his pub O’Sullivan’s in Crookhaven in West Cork.

The 39-year-old French woman was killed outside her holiday home near Toormore, Goleen, Co Cork on the night of 23 December 1996.

Despite countless investigations, the identity of her murderer was never revealed.

Mr O’Sullivan later shared his experience of talking to Ms du Plantier in the high-profile Netflix documentary series Sophie: A Murder in West Cork.

At the time, he told the programme she usually ordered a pot of tea and chatted with him and his wife, Angela.

"We knew her as well as anyone around here," said Mr O'Sullivan. "She was gentle and friendly, a very private person."

His family shared the news of his death on Monday morning, saying: "He had a very full and happy life. We will celebrate it as we try and understand our lives without him."

He is survived by his son Dermot and extended family.

A requiem mass will be held on Wednesday, December 17th at 12 noon in the Church of Our Lady, Star of the Sea and St. Patrick, Goleen.

This will be followed by a cremation service in the Island Crematorium in Ringaskiddy at 4pm.

Hacks United

Senan Molony and Michael Sheridan are true journalistic hacks, and they specialize in sensationalized articles. A simple trick they use to take a basic story, tease some heavily exaggerated details but leaving out others, encouraging readers to fill in the gaps with imagination, which naturally make the story look like there is a huge breakthough, but it often turns out to be nothing of the sort. They have both made a career of writing articles and books on this case.

Sheridan’s article in the Times made me think it was something to do with an interesting loose end – a call made to a hackney in the early hours of the 23^rd someone looking for a car for Toormore. The Gardai should have followed this up. But it's not about this call. Molony’s latest article, together with the previous one from Michael Sheridan, and an online tip has allowed us to piece together what they are talking about and fill in the gaps.

Links to the articles.

Michael Sheridan's article in the Sunday Times is here:

Fresh witness statement may open up Toscan du Plantier case

Senan Molony's article in the Irish Independent is here:

‘We remember’ – Sophie Toscan du Plantier’s family publish new memorial notice 29 years after her brutal killing

Chris Thomas, Jules Thomas, Fenella

Chris Thomas/Doe is the man who is alleged to have received the call while “in bed with the flu”.

This man is a former husband of Jules Thomas and is the father of Fenella Thomas. When he married Jules Thomas he changed his name to Thomas, though I will refer to him here as Doe. In 1989 Jules got a barring order against him. In the course of her interrogation on 10/02/1997 Jules claimed she was more afraid of Chris when he was violent to her than Ian Bailey and that Chris kicked her with his hob nail boots. He has a criminal conviction for sexual abuse of minors from 2009 for which he received a 6 year prison sentence.

Fenella Thomas is Jules third and youngest daughter. She is alleged to have made the call between 3am and 6am. She was 14 at the time of the murder. It was she who picked up the first call from journalist Eddie Cassidy at 13:40 on the 23^rd, passing it to Ian Bailey whereupon he and Jules went to the scene. She was the focus of Garda pressure for a few things she said. Firstly because she corroborated her sister’s observations that Bailey was scratched after climbing the Christmas tree and killing the turkeys on 22^nd which upset the Garda theory that Bailey was scratched during the murder. Secondly in her questionnaire she said that she heard Ian Bailey snoring between 2am and 3am on the morning of the 23^rd which contradicted the Garda narrative that he left the house and hiked to Sophie’s cottage in the middle of the night. Thirdly she said she had a “vague memory” of Ian and Jules leaving the house for a couple of hours sometime before 12 noon on the 23^rd. The Gardai have or had a theory that Bailey murdered Sophie in the early hours but then he and Jules returned and photographed the scene a later time in the morning before they photographed the scene at 14:20 in the afternoon – I don’t know, it makes no sense to me – but the Gardai were interested in the possibility Ian and Jules were out and about 9am-11am on the morning of the 23^rd and Fenella’s “vague memory” seemed important to them.

Alleged Early Morning Call

The articles by Sheridan and Molony are describing how a man (Chris Doe) has recently made a statement that he received a phone call in the early morning of the 23^rd December. He says it was a “panicked female” who told him that “something awful had just happened”. From Sheridan’s article, it’s clear that this man did not know the identity of the caller, “At the time I thought it was a drunken person or a wrong number”. “Five people [names redacted] and maybe one or two ... had my number”.

Sheridan claims that “Armed with fresh information the investigators narrowed their focus and identified the caller”. The question is how was this caller identified? Phone records from 1996 seem unlikely not just because records since that time are likely lost but also because we know The Prairie Cottage was not on a digital exchange at the time. My guess is they checked the five names on the list and they all said it wasn’t them, so they decided it must be The Prairie, the last number on the list.

Molony writes “The identified caller gave early statements to gardaí that contained major contradictions and anomalies. At one point she was arrested and questioned about these differences and discrepancies.”

This last sentence is the dead giveaway that he is talking about Fenella. Only Ian Bailey, Jules Thomas and Fenella have been arrested in connection with this case. More about her arrest and questioning below. Molony's description of Fenella's questionnaire from 1997 as containing "major contradictions and anomalies" is an outrageous twisting of the truth. Fenella said some things which contradicted the Gardai narrative but these were entirely consistent with what Bailey and Jules and her sisters said. I will discuss what Fenella said below.

However, we have to go back to Chris Doe’s first statements to the investigation.

Chris Doe's 1st Statement

Chris gave his first statement to Gardai on 6^th January 1997. For brevity I won't post the the whole statement here. He tells his history, marriage to Jules, breakup and her getting a barring order. He also describes Ian Bailey where he came from, when the relationship started how they had an altercation when Chris turned up at the Prairie, accusing Bailey of threatening Fenella (Fenella is on record as saying she never felt threatened). He also complains about Jules wanting to sell the studio cottage and he was taking her to court to prevent this.

What isn't in the statement is any mention of a phone call on the 23^rd December 1996 and nothing about a panicked female. He does mention getting a call on the 21^st . It was a woman with an English accent who said she was from Goleen looking for a "Will Thomas" who "used to live in Goleen". But that was 2 days before the murder and sounds more like someone looking for an old friend. That's all that his statement contains.

So the latest statement he has given alleging he received a call on the morning of the 23^rd is something he hasn’t mentioned in 29 years despite multiple opportunities to do so. Most notably when Fenella was arrested in September 2000 and questioned, Chris Doe was present as an appropriate adult. Knowing what we do about his convictions, this is itself quite disturbing. Did Fenella know about her father’s perversions?

Fenella’s arrest.

In 2000 Jules and Ian thought they had put the whole murder thing behind them. Family life had returned to the Prairie Cottage – this is described in an article by French journalist Caroline Mangez who checked in on Bailey during the summer of 2000. Ian’s father died in December 1999 and since then he was working in various odd jobs and indulging his passion for gardening. He built a new wing to the Prairie Cottage as a painting and exhibition studio for Jules and dug out a pond in the garden. They even went on holiday together in Crete. Fenella was 17 years old and was a student in Cork. She was hoping to pursue a career in modeling.

Then, without warning, the Gardai destroyed their family life all over again.

On the early hours of 21^st September 2000, Gardai arrived at Fenella student digs near Shandon St in Cork. She must have been in bed or only just up at the time because by 8:35 her interrogation began in Bandon. She was 17 at the time and still a child. Her father Chris was called to be present during the interrogation. Her arrest was followed the following day by a second arrest of Jules Thomas. By arresting and threatening her daughter, this was a strategy designed to put maximum pressure on Jules. Jules is on record describing this effect that these arrests and her treatment had on her was “devastating”.

Right from the start of her interrogation the Gardai put a lot of pressure on Fenella. They accused her of covering for Ian and asked her repeatedly why did she say he was snoring. After all they had an admission from him that he got up in the middle of the night.

Prudently Fenella took the advice of her solicitor and made no statements and signed nothing during her interrogation. However according to Garda memos she answered some of their questions. Regarding the snoring she said she couldn’t say who was snoring. Regarding her memory of Ian and Jules leaving that morning she said it was a “vague memory” of it.

In fact Ian Bailey has always maintained he got up later, between 6am and 8am. It is perfectly possible for Fenella to have heard Bailey snoring between 2am and 3am.

I have a copy of all the memos written by Gardai listing the questions they asked Fenella and her answers. I have combed through all these transcripts and a phone call was never mentioned by anyone, not Gardai, not Fenella, and not Chris Doe.

What appears to have happened here is some Garda gave the nod to Sheridan and Molony that they had interviewed Chris and they went and talked to him.

So what can we say about this? Chris obviously didn’t know who was calling at the time, otherwise he wouldn’t have suspected it was a “drunk person” or a “wrong number” or bothered mentioning the five people who had his number. Therefore he didn’t recognize his own daughter’s voice on the phone if it was she – which is rather difficult to believe. Also this “memory” is only being put to paper 29 years later, having failed to mention anything about this in his statement on 6/1/1997 and during Fenella’s arrest on 21/9/2000. That is quite an omission. Is a memory after 29 years even remotely credible?

But there more to know about Chris Doe. He is not a man of good character, to put it mildly, he may have a strong motive for ingratiating himself with Gardai.

Chris Doe's conviction for Sexual Assault

In 2009 Chris Doe was sentenced to six years in prison for sexual abuse of minors. The details below are disturbing, hence the NSFW tag on this post. This is taken from various newspaper reports on his trial.

Chris admitted sexually assaulting two girls, aged 8 and 9 at his home on various dates between January 2003 and November 2004. In court it was described how on one occasion, here moved his own clothes and posed with the two girls, got one of them to masturbate him and then got a seven-year-old girl to take photographs. He also pleaded guilty to knowingly producing child pornography from several girls, aged between 9 and 11. On some occasions the victims, were paid sums of €20 to €30 for taking off their clothes and having photographs taken.

This wasn’t just for his own consumption. He sold these pictures to others. From the reporting, I can’t tell how many victims he had, but its clear there were a number of them. When his house was searched, 76 images of child porn were found on a memory stick — 64 involving children in sex poses and 12 engaged in sex acts. Twenty of the images related to the two girls at the centre of the charges — four of which involved sex acts.

Six years is a laughably short sentence for this crime. I don’t know what happened to him after he was released from prison but we know well that the pattern of other men like this is they go back to their own ways, get caught again etc. We can also be very confident that this criminality didn’t start in 2003, but probably dates for decades before.

This is the man that Michael Sheridan describes as a “fresh witness”, whose testimony we are supposed to believe will “cast new light”.

You may judge for yourself the credibility of a man like Chris Doe.

A Conspiracy Theory built from Magic Memories

The Prairie Cottage was like Grand Central Station that Christmas. There were 8 people staying in the Prairie from the 23^rd December. A huge turkey dinner was prepared for the 25th. Ian and Jules were extremely busy, leaving aside the reporting on a murder. This would have been an exceptionally difficult time to clean up after an extremely bloody murder and act like nothing had happened. Fenella’s sisters and friends all made statements too. Everyone seemed to be out on the town partying in the days following the murder with nobody mentioning that Fenella was distressed or upset.

Despite her appalling treatment by the Gardai in 2000, Fenella met with French investigators at Anglesea St Garda station in Cork in October 2011. She willingly talked to them and answered their questions, though admitting that she remembered very little of the events at that time. This is not the behaviour of someone with something to hide. In any case, there were no questions about any phone call in the middle of the night. The French had all the files at this stage, so if Chris Thomas had mentioned a phone call from his daughter they would have been all over that.

Essentially what Senan Molony and Michael Sheridan are insinuating is literally a conspiracy theory – a conspiracy of silence between Jules, Fenella, Ian Bailey and Chris Thomas to say nothing about this for 29 years. Let’s remember that most of these people hate or hated each other. Chris Doe and Ian Bailey despised each other. Fenella hated Ian Bailey. Jules hated Chris and eventually kicked Ian out, and when he died she said she “felt nothing” anymore for him. Fenella’s sisters, their boyfriends and husbands have all been interviewed as well. They all intensely disliked Ian Bailey and were overjoyed when Jules kicked him out and yet nobody mentioned anything about a call in their statements. How are you going to keep the lid on a conspiracy like that? It’s absurd.

This “panicked call” story is like so many others in this case. For example, Billy Fuller’s hallucination of Ian Bailey at Kealfadda, or Bill Hogan’s recent daydream, or that time the Gardai tried to cultivate a prison snitch to nail Bailey while he was on remand in 2001. This last example is especially similar, the snitch (a man who actually raped his own daughter) wrote a cock-and-bull story that Bailey had confessed to him but later told others including Sam Bungee that he made it up to curry favour with the Gardai.

Long time followers of this case can see another pattern here, this is yet another magic memory which of something would have been super important to mention at the time, and yet the witness somehow didn’t despite multiple opportunities to do so.

After 29 years Gardai still trying break Jules Thomas

It is worth noting how unprofessional of the Gardai it is to leaking info like this to journalists , hinting that they will question or even arrest Jules Thomas in the near future. In fact Jules is on record saying "it was "farcical" that she had not heard from detectives since the review of the case began". It is especially urgent that they talk to her now, as Jules is elderly and is suffering from a serious illness. If Bill Hogan and Chris Doe are to be allowed make all sorts of ridiculous allegations, why hasn't she been given the opportunity to refute them? For the Gardai to delay interviewing her and drop hints like this is an outrage.

It seems this is just like old times – let’s try to “fucking break Jules Thomas” as the Det Garda Liam Hogan told D/Garda Jim Fitzgerald on a secretly taped phone call in 1997, because, as he admitted on the call, the actual evidence was “flimsy like”. Hogan wrote the first file sent to the DPP in 1997 including such gems as a statement from Diane Martin, who claimed to contact the dead spirit of Sophie using “psychic writing”. This would be funny if this wasn’t supposed to be an actual investigation into a horrific femicide.

I had hoped the Gardai had evolved since 1997, grown in sophistication and expertise, and professionalism. But now I see I was just being hopelessly optimistic. If these new statements from Bill Hogan, and Chris Doe are representative of the “evidence” the Gardai expect to present to the DPP, then it looks like the cold case review has been nothing but an expensive exercise in reading over old gossip and adding another layer of rumour and myth.

This is no basis for a murder charge even one for a dead man. The only thing that matters is if there is DNA found or not. If Bailey’s DNA is present at the scene, stories like this phone call are irrelevant and pointless. All the Gardai would have to do is show chain of custody for the exhibits and the file sent to the DPP could be one page long – we have his DNA, he did it, end of story.

But if Bailey’s DNA is not found at the scene, after four separate rounds of DNA tests, and almost thirty years of investigation of one man has failed to turn up any meaningful evidence, then it’s time for the Gardai to admit they were wrong, it wasn’t him. It doesn’t matter how many “repressed memories” you dig up, how much rumour, gossip, it all counts for nothing. The Gardai need to investigate in the one place where almost no investigation has taken place – to France.

One thing that really bothers me is that no one seems to care that Bailey assaulted his wife multiple times. Even in the documentary, he openly admits it and yet he hasn’t been charged with assault or anything in relation to this.

Additionally - it is also noted in the documentary that the Gardaí didn’t think that it was an issue, because things like this happen.....

Regardless of his guilt in relation to the murder, surely we should live in a world where it is so not okay to hit or hurt anyone else, and be blasé about it on television?

Because I'm so undecided myself as to whether or not I think Bailey did it, let's say he didn't. Who else could it have been? I personally really struggle with the hitman theory, given the manner of how Sophie died. It was brutal, she was chased, and to me all that sounds like the behavior of a man who tried to make a pass at her and she rejected him. The concrete block was picked up on the spot which sounds like it wasn't premeditated either as if a hitman would carry out a murder like that. Sophie rejected her killer close to the house, enraged, he started attacking her, she tried to get into the house but couldn't and she ran towards the road, he followed her, her clothing snagged on the brambles and slowed her down and the killer caught up with her. Whoever it was, that's my own belief as to what happened, but what does everyone else think?

I also can't buy into any theories that it was a woman who did it, for the same reasons as above, picking up a concrete block on the spot sounds like that of a strong and angry male.

Personally, the only other possibility that I can buy into is that of the local detective and he's been protected since but I'm interested to hear other's opinions, IF it wasn't Bailey then who do you think it was?

Now there isn't any doubt. It's not Bailey's DNA.

Michael Sheridan cranks out a yearly article in the Times today, with garbled information, stretching of the facts and some outright misrepresentation.

As Alison O'Connor wrote back in June "It's the femicide that keeps getting flogged". I guess Sheridan is nearing retirement now. It is a bit of a grab bag, but very little new content of any worth.

Sheridan writes about a "panicked female" calling in the early hours which is likely one of the many rabbit hole revisited over the years. There is a brief statement from a local hackney operator who took a call for someone who needed a taxi to Toormore, giving a possibly false name. Gardai have spoken to this person again and now the account is of a panicked female saying "something awful has happened". But if the person was "panicked" talking about "something awful" you would surely mention this in your 1997 statement to Gardai and not keep it to yourself until 2025, 29 years later?

Later he claims it is "Understood [Ian Bailey] obtained her Paris office number from her neighbour Alfie Lyons". This is absurd, and factually impossible for a two basic reasons. Firstly if Alfie had given Bailey Sophie's number he would have said so and secondly he would have given him the wrong number. Sophie moved out of her office on Rue Rambuteau in June 96 and she never gave Alfie a new number, because they hadn't talked in years. Even Josie Hellen gave Gardai the old office number plus her parents number back in 1997.

The only testimony that "a west Cork poet" called Paris before the number is from Agnes Thomas, who "remembered" this crucial information 18 years later, having given multiple statements and interviews right after the crime and in the years afterwards. She "remembered" this conveniently just before the Paris trial. Again I have to discount the reliability of 29 year old memories. This is especially true when the rememberer has made multiple statements and had plenty of chances to divulge their sensational memory to police in the past.

Furthermore if Bailey had known her number in France, he would have known her real name. He would absolutely have revealed she had a famous husband, if he had known, but in fact he was scooped by all the other papers on this. In his first article all he wrote was that she was a "professional Parisienne" called Bouniol which is what he learned from Alfie - because Alfie didn't know her married name either. The tired old lie that Bailey "offered a film script" gets another airing. Bailey once speculated the murder could be dramatized into a movie - fairly prophetic given that this has already happened, but there is no evidence Bailey ever wrote anything other than a rambling journal and some mediocre poetry. There is no evidence Sophie was ever offered a film script or any writing from anyone in Ireland.

There are plenty of other weird calls mentiones in the files - multiple calls to Mayo directory inquiries operators from a man who claimed to know who the killer was - a married man with four children apparently who lives "near the barrack". There is another statement from a man who describes his "ideas and thoughts" about the crime, which he says was a robbery by a man named Tony. The files are full of these rabbit holes which lead nowhere. Every new Garda fresh to the case finds them and we get articles like these.

Sheridan makes another misrepresentation later in the article.
Bailey did not "set out an account" of the killing in his diary. There is a page, published many times where Bailey wrote "I knew 23rd December" and a scribbled cartoon of someone shouting "help, help", which may or may not have been his idea of what the killing looked like. It is creepy but it's a single page with no other context whatsoever and certainly no "account of the killing". From the other stuff in the diary, my guess is he actually drew himself - his diary is full of moanings about how stuck he is in his life, about the injustice of the media and others hounding him, telling lies. He drew himself multiple times, styling himself as jesus on the cross at one point.

Now Bailey did write an account about the first days of the investigation, describing Shirley Foster finding the body etc. He was planning to write a book about the case. But what is fascinating about this account is that he got the details of the crime scene wrong. He described the body as "crouched near the gate" where in fact she was lying on her back. He thought that Shirley stopped before the body and only drove on when the Gardai told her. Most significantly, he made no mention whatsoever about the barbed wire - the most striking detail of the scene. All the first responders wrote about the body attached to the wire - but Bailey never mentioned this, nobody wrote about this until the pathologist's report was released in 2008. Bailey only wrote what the Gardai leaked and repeated what other journalists found. I have analysed his writings in detail. He claimed he was the "lead reporter" on the crime but in fact showed ignorance of the crime scene and the victim not insight.

Significantly Sheridan rather downplays the DNA results he hyped to the moon a month ago speculating why nothing has been released. "Briefings have diverged" - what I read from this is Bailey's DNA has not been found - the Gardai would certainly know by now. This is why he is playing the old, old game of "new witness statement may break open the case". If Bailey's DNA had been found on the block - you wouldn't need "circumstantial scaffolding".

But if DNA has been found, and it's not from Bailey - then it must be tested against the the enormous database in France. Assuming the profile is good, familial matching would find the owner.

Article is here.

Anybody else suspect that Ian presents as neurodivergent? After watching the sky and netflix documentaries, listening to The West Cork podcast on Amazon and reading numerous comments, I feel that Ian presents as high functioning autistic (asperges)/adhd which would explain a number of behaviours, his social communication style, his perception and the way that people feel about him being "odd".

I'm no expert but I have 11 years experience with neurodivergent people (being so myself) and just noticed behaviours that make me question this.

Just a thought.

10,000 Stolen Days

May 10, 2024 marked exactly 10,000 days since Sophie’s life was taken. 10,000 days which had they not been stolen from her in December 1996, must have seemed to be filled with possibility .1996 had been a banner year, she had achieved so much in the previous 6 months, setting up her production company "Les Champs Blancs", and producing three different productions, with more on the way. But it had been exhausting few months with all this work and travel, and although Christmas is a holiday, it is not always a relaxing one.

Christmas had often been a difficult time for Sophie. She walked out her first husband Pierre Jean at Christmas 1981, so suddenly, she left her infant son behind and had to steal him back with a ruse involving a relative. She broke up with Bruno Carbonnet over Christmas in 1993. leaving him a puzzling note;

“Je suis partie là où tu n'a jamais été, là où tu n'iras jamais".

“I have left there where you have never been, there where you will never go”. This didn’t make much sense to Bruno. He waited alone for two weeks in the apartment hoping she would return, he a had bought a bicycle for Pierre Louis for Christmas. In January he left to teach in Le Harve and when he returned the locks had been changed and all his stuff was on the landing. Sophie was deliberate about change in her life she didn't just let things happen to her. Her agenda year planners reflect this. She was meticulous in recording meetings, calls, contact details and travel plans. She brought 1995, 1996 & 1997 year planners with her. There are notes and reminders stretching into February 1997. She even tore off the little perforated corners as each week passed. It's a poignant reminder of how abruptly her life was cut off in full flow - the week beginning 23/12/1996 still has its corner intact.

Sophie’s style was austere, almost minimalist. Her cottage was painted white inside and out, except for the ground floor, which was black slate with a shiny varnish. The only decorations were a few sprigs of holly placed by the housekeeper to welcome her. A traditional Christmas week filled with loud music, tinsel and overconsumption was the diametric opposite of her character.

Worse there is the prospect having to trade pleasantries with tiresome relatives.

That Christmas Daniel had decided for the first time to have a big family Christmas inviting his extended aristocratic family to his chateau in Ambax in the South of France. For Sophie, who even after six years of marriage barely knew Daniel’s relatives, this was an easy choice and a hard no.

She bought her ticket on the morning of her travel planning to spend nearly a week in Ireland including Christmas Day and return on the 26^th. It may be that this was the only return flight she could get at the time. Or it may be, as she told her aunt Madame Opalka “she was going to go to Ireland to spend Christmas there, because the house in Ambax was full of people”. From what Daniel has said, and from what others have said, it may be he tried to persuade her to come to Ambax for Christmas and convinced her. Sometime during the weekend she got an itinerary by fax at the cottage confirming her flight back on the 24^th. But even on Sunday afternoon she told friends she had not made up her mind which flight she would take.

It is difficult to say how well their marriage was going at that time because the reports vary. Daniel said it was "harmonius and peaceful" which was far from accurate. There are several biographies of Daniel Toscan du Plantier, and they paint a vivid picture of a man who though incomparably charming, lived his life his own way without much concern for his family. He married four times and in three cases his wives were already pregnant before they got married. When he married Sophie, his eldest son and daughter were not even told about it, they only found out later in the summer when Sophie turned up at events.

Some witnesses including Daniel said was it was the happiest period, others say she was basically “an official wife” and that “their open marriage was an open secret”. The truth was probably somewhere in between. She had visited Ambax in November and collaborated closely on the documentary Europa 101 with Daniel. Whatever their personal arrangement, Daniel was deeply affected by her death, even though he refused to come to Ireland. His daughter Ariane wrote how she spent months taking care of him, feeding him sedatives and sleeping pills. He was clearly overwhelmed, so Sophie must have been more than an "official wife" to him. Was their marriage "open"? They clearly had a high degree of independence from each and had affairs in the past.

Nevertheless, Sophie may have balked at spending Christmas in Ambax. For one thing, it was far away from Paris, where her friends and family lived. For another, Daniel’s family and entourage knew very little about her. Apart from his second son Carlo, who was friends with her son Pierre Louis and some servants, she would have been on her own. Christmas in Paris would have been tolerable, she could escape and visit her parents and friends whenever she wanted, but in Ambax, she would be cooped up with nowhere else to go.

There is a question of whether Daniel was having an affair at the time. According to a Garda memo, French journalist Caroline Mangez said that Daniel was with a female film producer. However the files are full of unsubstantiated rumours and lies. Even if he wasn’t having an affair Sophie may have suspected he was. If Daniel had invited a mistress, or even a former mistress, or a former wife to Ambax, it would be unbearably awkward for Sophie. Daniel had uncountable affairs, and many of his mistresses knew each other, some remained on good terms.

Daniel may have been faithful at that time, perhaps he was telling the truth when he said their marriage was harmonius, but in any case Sophie had other reasons to skip Christmas. She had wanted to come to Dunmanus for months, but work got in the way. The heating had just been fixed and she needed to pay the plumber and her housekeeper. They preferred cash.

And if Daniel was unhappy that she wasn’t going to be there for Christmas, they were going on holiday together in the New Year to Dakar, Senegal. It would be much easier for Sophie to be with Daniel by himself than his whole family. This trip to Ireland would be a breather for her. She didn’t want to be alone, she asked at least 8 different people to accompany her, including 2 former intimate partners, though there is no evidence that she was having an affair or intended to have an affair.

There is a post-it note with a message in Sophie's hand seemingly inviting someone to spend Christmas: "Je vous laisse le choix : venir ou de refuser histoire que vous passiez un bon noel"

"I leave you the choice: come or refuse just so you have a good Christmas"

Whoever that note was written to, it was to someone she addressed as "vous" so not one of her closest friends or family.

Work

If she had another relationship, it is not obvious from her diary and it was unknown to her friends. What her diary does show though is that she had thrown herself into work.

Apart from her agenda she kept a working notebook, a red hardback book which is filled with a tantalizing mash of different references to famous works of art, music, and contacts details of artists and philosophers. She had recently completed work on three different films. The first work was a documentary on African Art. The next was Europa 101, a documentary written by Daniel showcasing the wealth of European cinema. This was Daniel’s pet project, he loathed US cinema and the dominance of Hollywood. He once likened his wife’s death to a “bad movie”. His life’s work was a “struggle against cheap portrayals of violence, which is what leads to deaths like this” (Irish Independent 12/07/1998). This project involved gathering interviews and footage from dozens of famous directors and actors, including John Malkovich, Ingmar Berman, Pedro Almodovar, Werner Herzog, Nanni Moretti, Jean Luc Godard and many others. It was broadcast on December 8, 1996.

The third was an art house movie called “He sees folds everywhere”, a concept movie exploring the idea of folds and creases in everyday life, in hanging clothes, paper, wrinkles on skin, folds of a human brain. This was a project of the director Guy Girard, and it was the work to complete this that delayed her trip to Ireland. But she had other projects in train in her notebook. She was researching Greek folk music, Rebetiko. She had a project or projects in mind which were somewhat dark in nature.

She was in contact with George Didi-Huberman who had written a book called “The Invention of Hysteria”. This is a photographic history of how Jean Marie Charcot – one of the giants of 19c French science – locked up thousands of women for the imagined maladies of hysteria, lethargy, catalepsie and experimented on them, deliberately photographing them in contrived and frightening poses. It is a very weird and frightening history.

Her next project seems to have been based around human fluids. Her final notes are filled with references to human flesh, death and the four medieval humours of blood, phlegm, black bile, yellow bile. There are extensive notes to what seems to be a lecture given by linguist Jean Claude Milner on the subject of melancholia. Note that “melancholia” is a synonym for “black bile”, one of the four humours.

She was researching the avant garde Irish/British painter Francis Bacon, who was known for producing uniquely disturbing images. She references “Three Studies for the Figures at the Base of a Crucifixion”. There was a Bacon exhibition in Centre Pompidou in 1996 and Sophie must have attended it. Her notebook contains her jottings from a lecture on Bacon by writer Philippe Sollers which seemed focused on blood.

"Why does painting touch the central nervous system?" "We are carcasses of meat, meat above all" "The canvas bleeds, blood spurts red" "Dostoyevsky had a crisis in front of the 16^th century Hans Holbein’s painting “The Body of the Dead Christ in the Tomb She jotted down a quote from the play Libation Bearers from Aeschylus:

Orestes sees the Furies coming and exclaims "O Lord Apollon look! Now they come in troops, and from their eyes they drip loathsome blood!"

The last entry reads "research the Furies"

Friday

Having failed to convince anyone to join her in Ireland for Christmas, she went alone. She telephoned Josephine on Tuesday 17^th, told her she would be arriving alone on Friday. She called her again on Thursday to ask her to make sure the house would be warm.

She went to the airport on Friday morning, bought a ticket with the return date on the 26^th, carrying with her a rather hefty bag filled with clothes, including some eveningwear. Perhaps she envisaged visiting people at Christmas time. She expected to stay nearly a week. Later, possibly on Sunday she changed her ticket, she called the Aer Lingus ticket desk in Charles de Gaulle airport, Paris and got a return flight for the 24^th. She received the itinerary details by fax, as she had a machine in the cottage.

She was not in a good mood when she arrived. She had some words with the woman at the Avis counter who passed her to her colleague. The photos on CCTV show a woman looking tired and drawn, something which was remarked upon by the Avis rep, who estimated she was in her forties, a little older than her 38 years. But nobody looks their best walking off an aircraft. She had also attended the Unifrance Christmas party the night before. This was a lavish party held in “Les Bains Douche”, a unique Paris nightclub combined with a swimming pool. Apart from the late night, the social effort must have been tiring. There was a rumour that Sophie had a row that night at Les Bains, a row with one of Daniel’s mistresses, but I have never heard that confirmed. But other reports say that those who met her there found her "radiant", "in good form", "playful". "She went arm in arm to see friends," one guest at the party told Paris Match, "but she always came back to the table where Daniel was sitting." (Paris Match 09/01/1997) Daniel was quoted years later by Michael Sheridan - “She spent some hours having an intense, passionate conversation with a film-maker” - Alain Terzian, producer of Les Visiteurs, one of the most successful French comedies of the 1990s.

Strangely though, Daniel’s first statement said she left on Wednesday. So perhaps it didn’t register with him that she was at the Unifrance party with him on Thursday 19^th, or perhaps he had forgotten the party altogether.

Sophie was captured on Cork Airport CCTV at 14:41 pushing a trolley through the arrivals gate. The scheduled arrival time was 13:20, but because of almost an hour’s delay in departure it didn’t touch down until after 2. It would have taken about 15 minutes to pick up baggage from the carousel.

Cork is a small airport and it is quick to get through the arrival hall to the car hire desks, only a matter of a few meters away.

Sophie hired a silver Ford Fiesta and would have been on the road by 14:50.

The quickest route to West Cork would have been via Bandon and Dunmanway but it is more likely she went via Clonakilty and Skibbereen. She stopped in Ballydehob to buy kindling. She may have stopped in Skibbereen to buy petrol. A pump attendant reported seeing a woman matching her description driving a silver Ford buying petrol. He also noted a tall male companion in the passenger seat. The Gardai discounted this sighting because they accounted for the petrol in the car when it was hired and the mileage thereafter. There were also some discrepancies in the vehicle’s appearance and its description in the statement. Also the Ballydehob sighting is more reliable as the woman got a chance to talk to her. It would seem odd to stop in both Skibbereen and Ballydehob, both petrol stations.

But she seems to have stopped again in Schull because she bought bread and cheese in the Courtyard Deli, and this was most likely on Friday. She talked with the proprietor, Denis Quinlan to ask if there would be live music. At this stage it would have been around 4:30pm and after this she went to the cottage. She called her caretaker Josephine at 5:15, so she must have been at home by then. We don’t know if she went out after that point. She may have stayed in. At 10:15 she called her friend Agnès Thomas and spoke to her for half an hour.

Saturday

Sophie’s whereabouts on Saturday morning are unknown. Perhaps she stayed in, perhaps she went out. Finbarr Hellen was working on his land nearby and saw her car outside the house 12 to 1pm. He didn’t see her and thought it was unusual for her not to come out and say hello. He also remarked her car was parked in an unusual place. He did not elaborate more than this.

The next event we know is that she bought some groceries in Brosnans supermarket on the main street in Schull and took £200 out of the ATM.

For the curious, her shopping list is listed below:

This list does suggest she was buying just for herself, but also that she planned to cook moderately elaborate meals with parsley, courgettes and chicory. Together with the cheese, bread and fruit already in the house she had enough food on there to last a few days. This quantity of food suggests she had not decided to travel home on the 24^th at this stage.

The till recorded a time of 2:49pm.

Sometime after this or perhaps before Sophie entered Tara Fashions, the clothes shop run by Marie Farrell. What Marie Farrell saw that day and subsequent days has been subject to revision, retraction and details seemed to be added with each telling. But I think the most reliable report is the first and all the subsequent revisions cannot be trusted. Farrell called the Gardai on the 25^th but they didn’t get around to taking a statement from her until 27^th. Even so we can assume her memory was fresh. Here is her statement, verbatim.,

On Saturday the 21st December 1996 I was working in my shop at Main Street, Schull, Co. Cork. Between 2p.m. and 3p.m. I noticed a weird looking character across the road from my shop. He was approx 5’10” in height, late 30’s, scruffy looking, long black coat, flat black beret, thin build, sallow skin, short hair. He was there for about 10 minutes. On Sunday morning at 7.15a.m. approximately I noticed the same man on the road at Airhill. When I saw him he was walking towards Goleen on the right hand side of the road and I was travelling in the opposite direction. When he saw me he stopped and put up his hand to thumb a lift. I did not see this man before or since. On Saturday the 21.12.1996 at approx 3p.m. there was a woman in my shop. She did not buy anything. I now know that this woman was the deceased woman from Goleen. I recognised her from the photograph on the television.

There is also a record of her questionnaire which may have been taken earlier than this statement.

In reply to question no 8 When/where did you last see him/her alive? She replied "saw her in shop. She bought a "Carrig Donn" aran sweater aran nap coloured, rolled neck late Sat aftemoon. Paid £39.00. Questions No. 9, 10, 11 & 12 were left blank. In reply to question No. 13 "any other help?" Marie Farrell replied "saw a man on Sat afternoon hanging around street. Desc late 30's, 5'10" very short hair wearing black beret. Saw him again Sun morning @ 7.20am walking towards Airhill but thumbed her.

In a later questionnaire, Farrell said the sweater was too big and she didn’t buy it.

What is interesting her is that Farrell does not draw any explicit linkage between the weird character in the long black coat and the woman in the shop. They were just there at approximately the same time. Farrell did say in later statements that the man followed her up Ardnamanagh road, but this was many years later. Her statements that she saw the same man at Kealfadda bridge at 3am on Monday are untrustworthy, but we won't go into this here.

A farmer, Frank Lannin, saw Sophie driving towards Schull from Goleen around 3pm. She saluted him as she passed him in his tractor. The time or the direction of travel must be wrong here.

The final sighting on Saturday she was seen in the Courtyard pub, eating a crab sandwich and left at 3:30pm. Sally Bolger went to feed her horses on Alfie Lyons land at 4:15pm and says she saw Sophie’s car at her house.

Saturday evening is a complete blank. Nobody saw her, she may have called people on the phone but we don’t have precise details. Her husband said she called him twice on Saturday, but we don’t have any confirmation of this.

At some point Sophie changed her ticket home. Her diary has a number listed as “O’Mahony” and the number was the line to the Aer Lingus ticket desk in Charles-de-Gaulle Roissy airport. The new itinerary was faxed to her in her cottage. The reason why she decided to come home early is not known. Her friend Jean Senet said her husband Daniel persuaded her. For his part Daniel said there was no particular plan and he was to pick her up from the airport at Toulouse at 8pm. Another report tells that she came home early to meet her father, so she could help him with his taxes.

Sunday

For Sunday morning we don’t have any reports.

She called to Dunlough at in the early afternoon, perhaps around 1pm. Sophie had walked here several times before. It is a spectacular headland featuring a lake and three crumbling castles. It was cold and dry at the time, good weather for a walk, if bracing. It is necessary to pass the farm to walk the headland and when Sophie did so she met Tomi Ungerer. This was the second time they had met. Sophie had called here in April but it seemed Tomi and his wife were having a row at the time and Tomi had not paid much attention. Daniel said that Sophie feigned a puncture as an excused to call to the farm. In June Sophie had sent Tomi a fax about the death of a mutual colleague, Gilbert Estève. She may have been seeking information or just making contact. Sophie made a habit out of making contacts with important artists and thinkers. It was one of the things that a colleague said of her, she knew all the right people. It is possible that Tomi was one of the people Sophie wanted to meet for a while. Tomi invited her in for a drink after she had finished her walk. She returned an hour later and they had a conversation over two glasses of wine.

Tomi was a renowned visual artist, with a keen eye and a professional interest in culture. Born in Alsace he was marked by World War II and had seen the ravages of the Nazis and the backlash from the French afterwards. He worked for as a cultural ambassador to improve Franco German relations.

The statement that Tomi gave is remarkable in the insight it gives to Sophie’s character her interests and state of mind.

“She was saying how great Ireland was for literature and education compared to France, how France had thousands of books published every year but that there was no good Authors there, how Ireland was vibrant as a centre of literature for a small Country. She discussed her family, moreover her children and their education in France. She indicated that the reason she was here in Ireland was she wanted to be alone for Christmas. I considered this strange but I sometimes like to be alone too. We talked about books and culture and how the language here was more meaningful and truthful compared to the superficial nature of the French.”

“She seemed a very genuine person, a fine person, not pretentious or snobby. I thought she was deep and intelligent, so much so that I made notes of some things she said, “In a language there should be no need of the use of cuteness” “The problem of France is her lack of modesty”. I wrote those saying they might be useful for my work in the futre. I wrote the quotes on a card in which we exchanged addresses before she left. On hindsight now I would go as far as saying she was not beaming, that she had something on her mind. It’s hard when you do not know someone well to say. I offered her a third glass of wine but she did not take any. We gave her some eggs to take with her, half dozen for her supper. We have hens.”

The word “genuine” is telling. Tomi was struck by Irish people, how the highest compliment an Irish person can give about another, is to say that person is “genuine”.

Tomi described her appearance:

“She was wearing some type of black leather expensive looking pants, brown suede hiking boots, a white/cream ribbed polo necked sweater and a beige wool blazer and a navy blue wool jacket with belt and a navy wool cap and red suede gloves, wine/red gloves. She was dressed very well. She had her hair tied back.”

As to her demeanor, this seems to have grown with the telling. The documentaries made much of the legend of the lady of the lake, whose appearance is reputed to be a harbinger of death. This lurid tale does not feature in the early Garda statements. Tomi remarked that “she was not beaming”, that she may have had something on her mind. His wife Yvonne turned up while they were chatting.

“While we were chatting, Sophie told me that while she was up at the castles she felt this great anxiety almost fear. This is not an uncommon feeling for people who visit the castles. She wasn’t in a cheerful mood but she wasn’t really glum either. She talked about her plans for the future and we spoke about meeting up in Paris in the Spring. She seemed happy to be here and she wanted to be here. She said she liked it here but her husband didn’t. She said she would be back at Easter. We made vague arrangements to meet over the next three days. I gave Sophie some eggs and she left here at about 5.45 p.m.” Yvonne’s estimate of the time she left must be an error. It is more likely she left at around 3:45.

After leaving Dunlough Sophie went to Crookhaven to Sullivans pub, a legendary stop. Here she spoke with the proprietor Billy O’Sullivan and his son Dermot, both of whom speak good French and knew Sophie from prior visits. They also knew her friend Alexandra Lewy. One time Alexandra had arranged to buy a cast iron church gate for Sophie’s birthday, Sophie was fond of antiques and bric-a-brac. Dermot had carried this gate up to the cottage. Sophie asked about getting logs for her fire. Dermot recommended she go to a filling station. She said there was only kindling at the filling stations.

It is interesting that so much of Sophie’s alleged stops and conversations were about fire, kindling, logs etc. Despite this, the photos from her house show she had a lot of fuel. There is a stack of logs, several bales of peat briquettes, what looks to be a 40kg bag of coal and one, perhaps two baskets full of kindling. She had enough for days of fires, unless she lit both hearths, which would be unlikely considering the second hearth did not draft properly, and she was arranging to have it fixed. The kindling may have been bought from Camiers Garage when Kitty Kingston reported meeting her on Friday.

She told her friend Alexandra before she left that she was going to sleep in the guest room because it was the warmest room, being directly above the oil range. There was also a brass bedwarmer found next to her bed. All these details point to Sophie being acutely aware of the cold.

A witness heard her discussing the old Coastguard houses with the Sullivans. These are a prominent landmark visible from O’Sullivan’s pub across the water. The witness left before Sophie did at 4:30pm so she must have returned to the cottage no earlier than 5pm.

The witness noted she was wearing “black leather pants and brown suede desert boots and a long chunky jumper”. This matches well with Tomi Ungerer’s account.

Note the "desert boots" seen by this witness and the "suede hiking boots" mentioned by Tomi Ungerer are probably not the hiking boots she was wearing when she died. The hiking boots she was wearing were very worn, the laces had snapped and had been tied halfway down the lace holes. They are also not suede. It looks to me she shoved them on without untying/tying the laces. Sophie would not have visited friends wearing old worn-out shoes. A pair of dark brown chelsea boots are visible at the bottom of the stairs in the garda photos. These look to be a better match better with the "brown suede desert boots" seen by the witness.

It’s 25 minutes drive from Crookhaven back to the cottage so if Sophie left at 4:30 she would have been back home before 5pm.

We know she most likely went home, because at 5:32pm she called her friend Agnès Thomas to wish her a happy birthday. Agnès was out so Sophie left a message.

The postman called at 6pm and noted the lights were on. Presumably he was doing a Sunday shift to cope with the Christmas rush. He didn’t see Sophie’s car, but as he only went as far as the lower gate, it is quite possible he missed it.

At 7:30pm she called her housekeeper Josephine but she was out. She tried her again at 9:10pm but again she was out. Josephine returned and called her back at 10pm. Sophie told her she would be leaving on the 24^th, not the 26^th as she originally intended. They arranged to meet the following day at noon.

Sophie’s phone records were not available, as the exchange she was on was a traditional analogue exchange, with no recording facility. Schull was one of the last places in the country to have such an old system. Days later Garda technicians tried to retrieve call details from her cordless phone but its batteries were flat and nothing was found.

At around 10:30pm she called her husband Daniel, who said he couldn’t take her call. He said he was in a meeting with Unifrance associates. As it was nearly midnight in France, this was an unusual time to have a work meeting. Daniel called her back “about twelve minutes later”. He said she was sleepy and probably in bed. Given that the cordless phone was found next to her bed, this seems plausible. He also said that she told him about her visit to the Ungerers and had formed a work project with him. He said she told him she returned home at 9:30pm, but he could be wrong about this. The phone calls to her friend and housekeeper strongly suggest she was at home from 5:30pm.

This was the last anyone heard from Sophie until her body was discovered at 10am the following morning.

From this point all we have is are the police photos and the story they tell is ambiguous, there are multiple possible interpretations.

The fire was lit that evening and there was an empty wine glass on the mantlepiece with dregs of wine in it. There was a loaf of bread, a white crusty “basket loaf” which had been sliced and left open. This is odd as there are no crumbs visible on the table and no plate. Would Sophie have gone to bed leaving the bread out? It’s possible. Another possibility is that the bread was sliced in the morning. But if so where is the plate that she used? Perhaps a vagrant called to the door and said he was hungry, Sophie would have cut some bread there and then and given it to him. This would account for the lack of plate.

Conceivably Sophie may have left these items from another evening, but it is more likely she consumed the wine that evening, possibly with some cheese she had in her pantry, and the bread she had cut. There was a book open on the table, propped open by a jar of honey next to an empty teacup. However as the cordless phone was found by her bedside, it seems likely this was all left from the previous evening.

It seems the most likely Sophie spent her last night reading, went to bed and then took the call from Daniel.

The book propped open was not a Yeat’s anthology. There is a tale repeated by many true crime authors that Sophie was reading a Yeats poem called “A Dream Death”. It contains the lines

I DREAMED that one had died in a strange place
Near no accustomed hand,

Ralph Riegel titled his book after this poem. But this is not the poem she was reading, if any. Yes there was a Yeats anthology found on her bed, but not the bed she slept in, it was on the bed in her personal room which she didn’t use that weekend. The anthology is “Quarente-cinq poèmes suivi de La Résurrection”, a collection of later Yeats poems translated by Yves Bonnefoy. It does not contain the poem “A Dream of Death” but it does contain a poem called “Death”, a meditation on how animals die versus men.

Nor dread nor hope attend A dying animal; A man awaits his end Dreading and hoping all;

But the Yeats anthology is not open on the bed, it is closed in the police photos. Unless the Gardai picked it up before photographing the room, then we cannot be sure what poem or poems she read. As regards the book propped open on the kitchen table, it’s prose and it is French. Journalist Lara Marlowe wrote that the book open on the table was a book about lighthouses. Senan Molony said it was "Cinéma et Moi" by Sachy Guitry. I have checked this book and it does not match.

Among the exhibits the Gardai took are three books

1. Le Coeur Battant – “The beating heart” – this is the title of a 1960 French movie.

2. Le Tenes Vert – Unknown – looks like a transcription error by the Gardai, could be “Les Terres Vertes”

3. Le Cine Monde – World Cinema

Other books in the house seem to correspond well with what we know of her character. On the landing there is another book from an Irish writer, Sean O’Casey, “Les Tambours de Dublin” in French.

On the shelf in her box bedroom we can see a book by Virginia Woolf, the title itself is illegible in the photo but Woolf’s distinctive profile photo is visible on the spine. It could be "To the lighthouse" a book about family and set in a holiday house in a remote western island with a view of a lighthouse. I wonder if the book might be “A Room of one’s Own”. This essay advocated that a woman writer could never accomplish anything unless she had financial independence and her own space to work in. Even if it was some other book by Woolf, this essay would have been known to Sophie. It hints at what the white cottage meant to her. Her tiny box room tucked under the gable and raised single bed was a quasi-monastic cell - a creative space, a room of her own in West Cork.

Did Bailey write details in his articles that he could not have known at the time?

Both documentaries on Netflix and Sky analyzed Bailey’s newspaper articles and made the allegation that Bailey knew too much, too soon about the crime and wrote details in his newspaper articles which he couldn’t possibly have known at the time, unless he had seen the scene close-up either as the murderer or secretly tramping around in the morning afterwards.

I have collected over 300 news articles on this story. There are still some articles I need to collect, particularly in French and some tabloids but at this stage I am in a good position to be able to test this allegation by looking at each detail and seeing whether Bailey was the first to write about it.

Before I begin, please note that Bailey only ever wrote about the murder for three papers :

• The Irish Daily Star

• The Sunday Tribune

• The Evening Echo, only one article on 03/02/1997 “Walking to her death”

So articles in any other newspapers were written by someone other than Bailey. I have detailed references for all of these articles, but for brevity, I have left some out.

Crime Scene Details reported by Bailey in his articles

I have listed out some of the details of the crime scene here

1. She was killed with a blunt instrument

2. Had wounds the the back of her head

3. There were wine glasses on the table

4. She wasn’t sexually assaulted

5. Found wearing laced boots

6. Concrete block used

7. There was hair in her hands, possibly from the killer

8. She tripped

9. There was blood on the back door

Let's take each of these details in turn

Detail #1 Blunt instrument

The first reference appears on 24/12/96 Belfast Telegraph “Gardai hunt French woman’s killer” – by Michael Devine. It then appears in almost every article after this point. Bailey’s first article with this detail was on 28/12/96 in a two page spread in the Daily Star shared with Senan Molony. “Glasses clue to the killer”

Detail #2 Wounds to the back of the head

More or less every newspaper wrote about head wounds. Eddie Cassidy wrote in the Evening Echo on 24th that the victim had "gaping wound to the back of her head". Cassidy wrote she died of multiple head injuries on on 27th. Bailey wrote about "repeated blows to the back of her head" in the Sunday Tribune on 29th.

Detail #3 Wine Glasses

The story of the two wine glasses first appears in multiple articles on 28/12/96. The Irish Times article “French visitor may have known her killer”. Bailey’s also had an article on 28/12/96 on this in the Daily Star “Glasses clue to the killer”

The origin on this info could have been the Gardai, as the Irish Times article quotes Superintendent J P Twomey. However on Sunday 29th, the Sunday World published an extensive interview with Josie Hellen, Sophie’s caretaker. Hellen said she had been let into the house soon after the discovery, it is not clear whether this was on 23rd (which would be controversial, as this was before forensics arrived) or on the 24th. In any case she described many of the details inside the house including the state of the bed, the wineglasses, a missing poker and many other details. The Sunday World article is "KILLER TRACKED SOPHIE TO BRUTAL DEATH IN IRELAND".

Detail #4 She wasn’t sexually assaulted

Bailey wrote this on 26/12/1996 in the Daily Star. This was presented as highly suspicious in Sky’s Murder at the Cottage Episode 2. How could he have known this as the post-mortem had only been conducted 2 days earlier and the pathologist didn’t write his report until March 1997. However when you look at the articles in other papers, it is clear Bailey did not have the scoop on this. The Irish Times wrote that “there did not appear to be any signs of sexual assault” on the 24th. Unbelievably this was before the post mortem was even conducted. However, the detail was repeated in both the The Irish Times and the Irish Independent in their issues for 25th December. Now the newspapers for 25th December generally don’t go on sale until the 26th or 27th so we cannot be certain when the copy was filed. But Carole Cadwalladr wrote in the The Daily Telegraph on the 25th that “A post mortem examination last night showed... There was no evidence of any sexual assault.” The Garda held a press conference on the evening 24th after the post-mortem so this is the likely source. From 27th all newspapers carried the same story, even Le Monde in France. "L'assassinat de Sophie Toscan du Plantier demeure mystérieux" Marc Roche.

Detail #5 She tripped

On 28/12/96 Bailey wrote in the Star that “As she ran from him in the dark, she appears to have tripped”. Again the documentary made much of this showing Jim Sheridan reading this line and commenting “Don’t know where he got that from” But it is likely it came from the Gardai. The Irish Times cited the Gardai “They think she fell in the boreen and, after trying to protect herself, her attacker dropped a heavy object, such as a stone or a concrete block, on her head.” (French visitor may have known her killer, 28/12/96)

Detail #6 Concrete Block

This detail first appeared on the 28th in the Irish Times, The Irish Independent and in the Daily Star in an article Bailey contributed to.

Detail #7 Hair found in her hand

This is variously described as a “clump” including by Bailey, but in fact it was only a few strands. It was first mentioned by the Irish Times and Irish Independent on the issues dated 25th. Bailey didn’t write about it until 28th December in the Star, by which time it was in many newspapers including the Evening Herald also calling it a “clump”.

Detail #8 Laced Boots

This first appeared in the Sunday World 29/12/1996 – KILLER TRACKED SOPHIE TO BRUTAL DEATH IN IRELAND. Bailey didn’t write about her boots until 5th January 1997

Detail #9 Blood on the back door

As far as I can see Bailey was the first to write about this. Bailey's wrote about it in a Sunday Tribune article on 29th. "Woman's killer thought to be local". The next reference to this is in the Daily Star on 4th January under the byline of Senan Molony. Molony was working with Bailey so we can surmise he got this info from him. Now we know that Bailey went up to see Alfie Lyons on 26th. Gardai insist he was not allowed to go near the house. The Netflix documentary showed pictures of Bailey nosing around the cottage, but these were taken late in January after the cordon was lifted. We do know he talked to Alfie Lyons and it was Lyons who found the blood on the door, so it seems likely Bailey got this information from him.

Errors made by Bailey in his articles

By contrast to the allegation that Bailey knew too much, there is also a number of cases where Bailey clearly knew too little. Here is what I have found:

Error #1 Discovery

In his earliest article "Questions on victim's final hours" in the Star on 26/12/96 he wrote that the body had been discovered by Finbarr Hellen. This was incorrect, it was discovered by Shirley Foster, but was identified by Finbarr Hellen.

Error #2 Pursuit

In the Sunday Tribune on 29th “Woman’s killer thought to be local” – Bailey wrote she was “Pursued down the rocky track”, This is incorrect because evidence shows is that she was pursued down the field and not the track because of the blood found on a stone in the field.

Error #3 Shirley's car

Bailey wrote in his diaries that Shirley Foster was allowed by Gardai to drive past the body. This is false, in fact Shirley Foster drove past the body before she realized and stopped the car. This detail was not known until many years later, so Bailey could not have been present or watching when this occurred. He was quoted elsewhere that two cars were allowed to drive past the body.

Error #4 Body was not found in a crouched position

Bailey wrote in his diary that Foster saw the body "crouched near a five bar gate" The body was not found crouched, it was found flat on its back.

Error #5 No bottle of champagne

Bailey wrote about a bottle of champagne found on the kitchen table. No such bottle appears in the crime scene photos, nor in the list of exhibits.

In summary I cannot find any evidence that Bailey knew more than he should have based on his writings, and in fact there evidence that he was ignorant of key details that he would have known if he was the killer.

Any other detail you can think of I should analyze?

So I have been researching this "premonition" or "feeling of foreboding" that Bailey allegedly had on Hunt's Hill. Here is the result:

During her arrest on 10th Feb 1997, Jules talked about Ian stopping on Hunt's Hill on the night of the murder and looking out across the bay: "Ian got back in the car and said he had a bad feeling about something." She signed this statement.

During his arrest on 10th Feb 1997, Ian Bailey signed a Garda note of the interview which stated: “I had a premonition something was going to happen.” When they asked him more about this, he replied, "I won't put it any further. I don't want to." (Nick Foster). In court, in 2014, Ian agreed he signed this note. (Irish Times 14 Nov 2014) (Irish Independent 14 Nov 2014)

From the DPP report: "Jules Thomas makes "reference to Bailey stating that he had a feeling that something bad was going to happen. This would have been about 12.45am on 23 December 1996." (The DPP is estimating this time himself).

In court, in 2003, Bailey "admitted stopping his car on a mountain road which overlooks the area where Sophie was killed on December 22 and having "a feeling.""Yes, I did have a feeling. But it was a feeling rather than a premonition. I think they were trying to make it out to be more than it was," he added." (Irish Independent 12 Dec 2003)

In court, in 2007, Ian "vehemently denied having told a West Cork friend, Yvonne Ungerer, that he had had a dark premonition as he drove home from Schull on the night of December 22. He denied having said to her: "These premonitions usually come true."" (Irish Independent Feb 16 2007)

In 2014, Jules denied telling gardai Mr Bailey said to her, when they stopped at Hunt's Hill near Schull sometime earlier that night on their way home, he had a feeling something bad was going to happen. That was "absolute invention", she said. Asked about garda notes recording she had said Mr Bailey asked her at Hunt's Hill was that "Alfie's house" over there, before saying there's a light on, she claimed Mr Bailey had not said that and a note by gardai recording she had said that Mr Bailey had said he was going over there later was "pure invention". She said It was not possible to see the house of Alfie Lyons from Hunt’s Hill as there were no lights and it was dark. (Irish Independent Nov 29 2014)((Irish Examiner Nov 29 2014)

From Philip Boucher-Hayes' interview with Ian Bailey in 2016 on RTE Radio 1:

Boucher-Hayes: "On the night of the murder, after leaving the pub, you went to a place called Hunt's Hill and while looking at Sophie Toscan du Plantier's house, you expressed a sense of foreboding. Did that happen?"

Bailey: "No it didn't. We went home over Hunt's Hill where we stopped momentarily to have a look at the lights over the bay..."

Boucher-Hayes: "And the sense of foreboding?"

Bailey: "No. I don't know where that came from."

Boucher-Hayes: "But you didn't have any sense of anything ominous about to happen? You didn't say anything to your partner [Jules] about it?"

Bailey: "No. I didn't."

Ian was interviewed on RTE Radio's Drivetime on 8 Aug 2016:

Interviewer: On the night of the murder, you and Jules were driving home from the pub and you stopped the car at a place called Hunt's Hill. Now the arrest warrant says, and I'm quoting, At that moment Ian showed her the house where Sophie lived and said that he had a premonition that something bad would occur there. Did you-?

Bailey: No No, I mean, that's a total fiction. That's a completely made up statement. We did stop on the way back, briefly. The bit about the premonition and the pointing out of the house is a total and absolute fiction.

In RTE's "The du Plantier Case" Documentary broadcast on 24 July 2017, Jules said: "...it was around midnight - 12:30 before we thought of coming back. Ian went and got the car and we drove on home. He said at some stage, he had a funny feeling that something was going on. It was very strange - something's going on somewhere."

So, basically, Ian and Jules are very clearly lying now. They are claiming the gardai concocted these statements in order to frame Ian, but it is obvious they actually did make these statements.

Sophie was only in the country 72 hours before her body was found. Who did she meet/communicate with on Day 1? Fed up reading post- Sophie analysis pre- Sophie must be where the truth lies.

20/12/96

These are google maps distances today & I know road conditions & cars may slightly change the time/mileage between 1996 and 2021 but not IMO substantially:

Cork Airport – Skibbereen – 1 hour 12 mins/ 47 miles/76.2 km (Arrival time?)

Skibbereen – Ballydehob – 15 mins/10 miles/ 16.2 km

Ballydehob – Courtyard Bar – 9 mins/4.9 miles/7.9 km

Courtyard Bar – Sophies house at Toormore – 9 mins/5.5 miles/9 km

Assuming she spent 20 mins getting thru the airport & picking up rental car, 10 mins on first petrol fill up at Skibbereen (although was the tank not full on pick up?), 10 mins at 2nd stop for firewood in Ballydehob, 30 mins for coffee at the Courtyard Bar, her flight landed at what time? From Cork Airport to Toormore (with known stops) would have been roughly 3hrs. If she was in The Courtyard Bar at 3.30-4.00 pm I’m guessing her flight was in at 12.00- 12.30 pm ish. Can anyone verify this? The flight time that is. Sean Murray (from what I can find) only says he served someone matching her description “in the afternoon” of the 20/12/96. Does anyone know the time her flight landed? Please point out any bad calculations/info.. I don’t know if this is right.

20/12/96

Time of arrival at Cork Airport? – I’m assuming 12-12.30 pm ish. The first person she was seen with, if Murray was correct, is the man who was in the car at Skibbereen (1 hr 12 mins from Airport) and no longer in the car 15 minutes later at Ballydehob where she bought firewood (according to the Garda Crimeline programme). In Skibbereen he paid £10 for petrol – can we assume he was Irish or living in Ireland as euro currency was only introduced in 2002. Sophie may only have had francs although she bought firewood at the next station. Can we check the passenger list for the flight to rule out that the passenger in the car travelled with her. Did someone, in France agree at the last minute to go with her? She didn’t seem to want to travel alone. Or did someone greet her at the airport and travel with her to Skibberreen ?

If he was Irish or living in Ireland why did he get out of the car between Skibbereen and Ballydehob? Where was IB on 20/12/96 – does he have an alibi for where he was between 12.30 pm – 2.30 pm on 20/12/96? Was this man the same man that MF saw at the bridge and stalking Sophie on 21/12/96 when she went shopping & bought Le Monde in the local Spar. Wouldn’t have thought there was a huge demand for French newspapers in the town but maybe a few copies were ordered for French people living locally. Or did the shop know she was coming and ordered it in for her. The more people who knew she was coming, the wider the net of suspects, no? As we are now aware MF has id’ed this man as French and a friend of Daniel & Sophie. I don’t know MF or have any idea of her character or reputation but I’m just assuming she landed herself in a mess & there’s some grain of truth in what she’s saying now. I don’t find it unfeasible that you would recognize someone (a stranger) you had seen the day before late at night. Car headlights throw out a fair bit of light & you could recognize their gait, general look especially if you had noticed them very specifically the day before.

(Jumping forward but still trying to stay within her first few hours in Ireland on 20/12/96)

Was this the same man that went into Sweeney’s Travel Agent’s in Loughrea, Co. Galway just four hours after her body was found (approx. travel from Schull to Loughrea, 4 hrs) looking for a hotel room hear Dublin Airport and details of B & B’s in West Cork where he said he forgot to pay the bill. Again, surely passenger lists of flights out of Dublin on 23-24/12 could be checked. If he travelled with Sophie he would have to use the same passport to get out again (although if he was clever, he may not have travelled directly back to Paris). In addition, were any B&B’s not paid that day in West Cork? Surely, that would have been reported by the B&B owners post the discovery of Sophie’s body. Maurice Sweeney reported this to the Gardai on 27/12/96 and stood by his word in 2008. Apparently he id’ed the man who called into the travel shop as a friend of Sophie’s after being shown a photo. Most small scale business people (this was pre Celtic Tiger Ireland) remember vividly a potential customer. Did the gardai check this out?

I’m aware that this all depends on whether Murray was right in id-ing Sophie in Skibbereen but I would have thought any other petite, blond woman would have come forward by now if she had visited the petrol station in a blue/green/silver Ford Fiesta that day.

After getting firewood (according to Garda Crimeline report) in Ballydehob, she went for tea at the Courtyard Bar between 3.30-4.00 pm. I had the impression from the Sheridan & Netflix documentary that she always visited this bar for tea when she was in the town. Again, from the documentaries the owner was very sympathetic & upset at what had happened. I don’t, for a second, think he had anything to do with it but just trying to stay focused on what she did that day.

On arrival at her house she spoke to Josie Helen, her housekeeper by phone (again according to Garda Crimeline report). Who is she? Is she still alive? Did they discuss the heating/breaking in & bathing in the house thing? How well did Sophie know her?

By all accounts she did nothing else that day. Roughly 5 pm?

So, the man in the car, the two petrol/firewood stops, the tea & scones stop & contact with Josie Helen are the only people she apparently communicated with that day. Did she not phone her husband/child on arrival at Toormore? If Murray was right, the man in the car is crucial to finding out what happened. Also, it would be interesting to know who else was in the bar when she had her tea? Who knew she was in town?

Truth is, if she had no idea anyone meant her harm she probably went to the house that day, delighted to be in her own oasis/retreat, read, thought, chilled out a bit & went to bed. The question really is can we assume she travelled from France alone, met some randomer she gave a lift to who paid his way with £10 for petrol & dropped him in Skibbereen or she travelled with someone on that first day but didn’t want to draw any attention to it & dropped him off to find his own way to the house. I know this is very speculative but prefer to stick with what we do (kind of) know and move out from there. Anyone know her time of arrival? because if she was in the Courtyard Bar between 3.30 & 4.00 pm, she was at Ballydehob at (roughly) 3.15, Skibbereen at (roughly) 3.00 and Cork Airport at 12.30 pm. Can anyone confirm her time of arrival? I reckon the key to finding out who did this is to know who she met/had contact with on Day 1.

Not directly relevant to above but given I’m implying it could be a French person who travelled with Sophie who ended her life it may be relevant to see what she was working on at that time. By all accounts (& I don’t know for sure) she was working on a number of projects at the time:

· Guy Girard, a French film director met Sophie just six months before her death when they worked together on a film project. He was interested in making a film about a man who killed his wife with an iron bar – human tragedy type thing. According to him she mentioned IB several times but he didn’t come forward until March 1999 and gave a statement to Bantry Garda Station. Is that not odd when IB was first mentioned as a suspect in early 1997 and it was big news in Paris.

· Vincent Roget collaborated with Sophie as a producer and was a friend of GG. He spoke to Gardai in 1997 but did not mention IB. He was also working with her at the time of her death.

· VR said that GG said Bruno Carbonnet (Sophie’s lover who had spent time with her in Toormore) was a “psychopath” who cut up pictures/paintings and sent them to Sophie after they split up. BC had been in contact with Sophie a few months before her death and asked her for one of his paintings (for exhibition) which she still had.

· BC says when he was in Ireland, they had an “odd” encounter in a bar with “a man from Marseilles” between ‘91 and ‘93. The guy apparently was aged 40-50 yrs old with an “athletic body”.

· A fisherman, originally from Marseille who lived in West Cork killed himself three months after Sophie’s murder. Gardai did not suspect him by all accounts.

My typing up of (partial) statement given by Guy Girard to Bantry Garda Station on 16/6/99.

I hereby declare etc.

I have been involved in the film industry since 1978 but I did not direct films until I first met Sophie Bouniol, she did not use her married name, Toscon du Plantier very often – in June 1996.

I was introduced to Sophie by my friend Vincent Roget. Vincent had been working with Sophie for some years as a producer on some projects. Sophie had an idea for a new project and I was asked to direct a film subject for her. The name of Sophie’s film company was “Les Champs Blanc” (The White Fields). At this time, I was completing another project so I did not join Sophie and Vincent until October 1996, to work on the new proposal.

At our production office there were mainly three people, Sophie, Vincent and myself. October and November 1996, I would have worked on this project perhaps three times a week at Sophie’s home. The remainder of the time I spent at the office. We were of course in contact all the time by telephone*. In November, 1996, I was invited to present some of my old work at a festival of film in the south of France at a large College. I showed my film “Le Flaca” La flaca Alejandra (1994),which I make in Chile in co-operation with Channel 4. This film had a theme of treason and repression.*

During a conversation with some of the teachers after the showing I indicated that I was working of a new project called “Le Plie” (“The Fold”). It was suggested to me that I include details on an incident which happened in the town of nearby Beascon involving a man who killed his wife by hitting her with an iron. The man’s explanation to the police for killing her was because their marriage was taking a bad turn. In France we say this as “Mauvais Pli”. It was because of the “Pli” …. (Can’t read that) Pli suggestion was made. When I retuned to Paris I discussed with Sophie the reaction from the college. We discussed for a long time the theme of human tragedy and during this time Sophie mentioned the name of Ian Bailey. I am sure of this. I thought Sophie was talking about famous French film director………………. .(you’ll find the rest on regular media) , I don’t want to go over that again. I can’t find the full transcript of this interview so just typed out the bit I can find.

So, clearly the idea of domestic violence (as a theme) was big in Sophie’s head when she arrived in Ireland. She (from a work point of view) would have been thinking about this when she came to Ireland. I’m not suggesting GG or DTDP or VG or indeed IB were involved in her death but the fact she was working on the very thing that happened to her means she would have been open to meeting someone who was also interested/had knowledge of it.

Obviously the first person you think of regarding domestic violence in this story is IB. Did Sophie read Irish media/know about IB and what happened to Jules. He definitely seemed to be trying to come to terms with what he had done in his writings and conversation. On the other hand, is it not odd (again) that GG did not come forward with IB’s name until 1999 long after it became known that IB had hurt JT so badly. Again, IB would be the perfect fall guy to cover any involvement from France.

If it’s possible all Sophie’s phone records between Toormore/Ireland/France from mid December 1996 should be looked at along with all flight records in and out of Ireland. If IB was in touch prior to her arrival there must be a record. This case moves in so many directions because of the total lack of any forensic evidence but if we could find out who was in the car (if anyone) on Day 1 it would surely lead us to the truth.

‘A team of forensic experts from the US has travelled to Ireland to examine evidence from the murder of the French film-maker Sophie Toscan du Plantier with groundbreaking new DNA testing methods.

The group, headed up by Jared Bradley, chief executive of M-Vac Systems, flew from company headquarters in Sandy, Utah to Dublin this month to test samples preserved from the crime scene in west Cork.

It is understood the tests focused on a heavily bloodstained flat rock and concrete block believed to have been used to batter the mother of one to death near the entrance to her isolated holiday home outside Schull before her body was found on the morning of December 23, 1996…’

Introduction

The Gardai's and French 27 year pursuit of Ian Bailey's pursuit is well known. It destroyed his life and most likely contributed to his early death. But what is less well known is the harrying and pursuit of Jules Thomas, his partner of 25 years. If Ian Bailey murdered Sophie Toscan du Plantier, Jules Thomas would know, this is as obvious now as it was to the Gardai back in 1996, Jules, her family and their friends were the levers the Gardai tried to use to nail Bailey. Despite this, to this day, with Bailey dead and gone, Jules maintains his innocence. A central plank of the Garda and French case against Bailey is Jules' statement she made on her first arrest, but as I will show here, this statement is extremely suspicious and reeks of Garda corruption. To compile this, I have used the actual Garda statements, custody records, and other materials such as the Bandon Tapes and court transcripts.

The First Arrest

The West Cork podcast described the arrests of Ian Bailey & Jules Thomas on 10th February 1997 thus:

Years later one detective would describe that day as the apex of the STDP investigation. Everything that happened before built to this point and everything that came after trailed away. There would be further developments in the case, but they would all just take the guards further away from their hopes of a prosecution. This is as close as they got.

Now, thanks to the files and documents revealed by the French trial in 2019, it is possible to analyze that day hour by hour. We can see what the Gardai believed, expected to achieve and how it all went wrong.

Reams of material has been written about Bailey's arrest, documentaries and podcasts, but Jules' arrests are universally relegated to a sidenote, if they are mentioned at all. However the harrying and hounding of Jules is central to how fixated the Gardai were at getting confessions instead of gathering actual evidence.

But first we have to understand the context.

Getting a confession

By the end of January 1997, the pressure on the Gardai to resolve the case was immense. The media interest was at a peak. RTE Crimeline broadcast a dramatized reconstruction on 20th January and this had been seen by half the country. The family of the French victim had started proceedings in Paris to obtain access to the file and were applying political pressure. Her husband Daniel was a personal friend of the French president, Jacques Chirac. Gardai had a suspect but the evidence was thin and circumstantial. The most compelling evidence was that the suspect had been seen by a witness near the scene around the time of the murder and he had apparently admitted the killing to the editor of the Sunday Tribune. But this wasn’t enough. The witness had seen him 2 km from the scene, and the admission to his editor appeared to be ironic. There were hopes for the forensic material sent for analysis, but the results would not be available for weeks. Waiting for these results was not an option. They had to make an arrest. But they had a plan.

Their plan was an intense, aggressive interrogation to psychologically break the suspect in the hope he would confess. This was a gamble, but the Gardai had long (though controversial) experience of obtaining confessions through interrogation. There was a well known Garda “Heavy Gang” operating in the1980s. In some cases, e.g. Sallins Train Robbery they obtained confessions through direct physical beating and threats, but mostly their method was psychological. Especially effective was the simultaneous interrogation of close friends and family of the suspect.

Perhaps the best example is the Kerry Baby case, where the Gardai managed to get five members of the Hayes family to sign confessions to the murder of an infant found on a beach. Forensics tests conducted shortly afterwards showed that they could not possibly have done this and all these confessions were false. They weren’t physically beaten, but they were subjected to 12 hours of intense interrogations, each member interrogated separate and simultaneously with the others. Joanne Hayes herself said that the Gardai told her her family would be imprisoned, her child put into care and the family farm would be lost, if she did not confess.

By 1996, ten years after this case, the Gardai Heavy Gang were all pensioned off but many of the interrogation techniques they developed persisted.

For example, during the investigation of the murder of Veronica Guerin, suspect Paul Ward was being interrogated his girlfriend Vanessa Meehan was also arrested. During the subsequent trial the court recorded:

"As to the visit from Ms. Vanessa Meehan to the accused, the court accepts her evidence that she was successfully subjected to grievous psychological pressure by D. Sergeant Hanley and perhaps officers also to assist the police in breaking down the accused who up till then had maintained consistent silence over many interrogation sessions."

Note D/Sgt Hanley was the Garda assigned to interrogate Jules before her arrest on 10/2/1996.

A carefully choreographed operation

Simultaneous interrogation was a key part of the Garda strategy to get a confession from Ian Bailey. But the key to the plan was to pressure Bailey’s partner, Jules Thomas. Bailey had violently assaulted Thomas back in May. She had taken him back, but the Gardai believed she was covering for him. If Bailey had committed a brutal murder in the middle of the night, even if she wasn’t involved she must have noticed something. In the eyes of the Gardai, Jules Thomas was the weak link.

On the morning of 10th February Garda called to Jules Thomas’s house looking for Bailey around 9:30 and she directed them to the Studio cottage 150 meters up the road. Bailey rented this cottage from Thomas before they became a couple. The Gardai left and went to Bailey’s house. Then two more Gardai arrived at the Prairie and began to question Jules. Jules and Bailey were then questioned separately for an hour, one in the Studio, one in the Prairie for an hour. The Gardai made no mention of an arrest.

Bailey was arrested first at 10:45. The Gardai then drove Bailey back to the Prairie Cottage where Jules saw that he was in handcuffs. This was a deliberate ploy by the Gardai to show her that Bailey was being arrested. It was important for them both to know the other was being questioned. This is the essence of the “Prisoner’s dilemma”. Each one knows the other’s story is being compared to their own.

Shortly after Bailey's arrest Gardai called to Beryl Thomas's, Jules's mother, ostensibly to carry out a search of her property, but also to inform her that Bailey had been arrested and ask her questions about him and the assaults. Of course they knew this would also pressure Jules. Jules Thomas was questioned for another hour before she too was arrested at 12:22 and she called her mother. She was in a panic, her 14 year old daughter Fenella was at school and needed to be taken looked after.

The reasons the Gardai didn't arrest her or Bailey immediately, was simple. The longer the Gardai could question Thomas before arresting her, it delayed the start of the 12 hour countdown after which they would have to release her, giving them more time. Additionally, questioning a suspect who is not under arrest may give that person a false sense of security, or they may reveal something or lie to police which gives further grounds for arrest.

Beyond the simultaneous arrests and interrogations, the Gardai planned the day as a media event. The press were leaked details beforehand and there was a mob of them waiting for Bailey and Thomas to arrive. Bailey's name and photo appeared in the Sun. But it wasn't just tabloids, RTE had a camera crew ready when Jules Thomas arrived. She was shown being frogmarched into Bandon station on the RTE news at 6pm.

There is proof that the Gardai leaked the impending arrest, because on Sunday 9th February, the day before their arrests, an article appeared in the Sunday World which all but named Bailey as the suspect indicating he was about to be arrested.

The article entitled “SOPHIE HUNT GARDAI ARE CLOSING IN ON KILLER” stated that an arrest was imminent of a “non-national” who has a “small holding” and “a history of violent attacks” “moved to the area a few years ago”. He had already been questioned by officers. “the man was seen with severe scratches to his face. When questioned by Gardai the man said he had received the marks as a result of a farmyard accident”.

The operation was not confined to West Cork. In addition to the arrest of Ian Bailey and Jules Thomas, the Gardai were interrogating Thomas’s daughters Saffron and Virginia. They weren’t formerly arrested, but Gardai called to Saffron’s home in Bray, Co Wicklow and Virginia, who was a student living in Dun Laoghaire, County Dublin. Between all of these interviews, the Gardai hoped to find inconsistencies. Simultaneous interrogations of everyone except Fenella, who was 14 at the time.

To apply psychological pressure, it's important to understand the other's weaknesses. With Bailey, the Gardai felt he was boastful and secretly eager to confess. But with Thomas, her weakness was her family. A successful artist and mother of three daughters, she had a lot to lose. When a Garda called to Virginia later in the evening, the only question he asked her was

"Did you recognise anybody on the 6 o’clock news on R.T.E.?"

Running out of time

But the interview of Bailey did not go according to plan. Bailey talked, but would not confess. The Gardai threw everything they had at Bailey. They had found bloodstained clothes seized from his house earlier that day . They had a witness who claimed to have seen him near the scene. All this was put to him, but by evening time the 12 hour detention period was running out and it became apparent that Bailey was not going to crack. All they had was denials from him that he had anything to do with the murder, that he had been in bed all night.

But, sometime after 8pm Bailey changed his story, saying that he remembered now he had left the bed in the middle of the night to do some writing. Bailey said he had an overdue story to write for the Sunday Tribune. The Gardai put it to him that this was because Jules Thomas had told them.

At this stage it would be useful to see if we could dovetail this with Jules Thomas’s interrogation, find the moment when Jules revealed this important point. However, the memos for this period of Jules Thomas’s detention are not available, they were never written. We will come back to this.

This was progress, but time was up and it wasn’t enough for a charge. Bailey was released from custody and signed the custody sheet at 10:44pm. Strangely the final memo of interview was signed by Bailey at 0.05 on 11th February over an hour after he was released. Bailey was dropped by Gardai to a friend’s house in Skibbereen (Russell Barrett). Witnesses reported Bailey arriving between 12 midnight and 00:30, Skibbereen is almost an hour’s drive from Bandon. Therefore Gardai, presumably very anxious to complete the paperwork, got Bailey to sign the memo in Skibbereen after he arrived. Remember this point, the Gardai were careful to get Bailey’s signature on everything.

Although they hadn’t got a confession from Bailey or a charge, the guards put on a brave face. Superintendent Noel Smith appeared on the steps of Schull Garda station saying:

“You look more disappointed than I am! I suppose you thought I was going to be bringing a head out?” exclaimed Smith in front of the cameras, making a black joke to lighten the mood.

However, with Jules Thomas though, the Gardai felt they had a breakthrough.

In the final minutes of her 12 hour detention the Gardai succeeded in getting a statement from her that was highly incriminating for Bailey. It undermined his alibi, undermined his explanation for the scratch on his forehead. It provided the crucial criminal opportunity for Bailey to commit the murder, because she said that he had seen Sophie in town on Saturday and that he had seen a light on at the house of Alfie Lyons, neighbour of the victim, on the night of the murder. Finally she stated that he told her he was intending to travel to Alfie’s that night. This placed him at the scene of the crime, at the time of the crime, with knowledge of the victim, and with a fresh wound on his forehead that was not there before the murder.

The case falls apart

With this statement, and with forensic test results to come the Gardai were very hopeful of a charge.

However, just two days later, on 13/02/1997 Jules Thomas went on the Pat Kenny radio show and blew the garda case apart.

She repudiated everything she had signed. She said she was convinced Bailey was innocent, claimed the Gardai had lied to her telling her that Bailey had confessed, and that she was forced to sign the statement.

In the interview Jules vividly explained the intense pressure she was put under.

PK So you are completely convinced of his innocence? You would find it difficult to continue living with someone if there was any hint in your mind that he might be capable of something....

JT Absolutely. Absolutely, I wouldn't, you know, as I said at the end of my um interview, I was, I was pretty well forced to make a statement or they were going to take me down and charge me, so I was thinking of the consequences I have three daughters, two at college and one at home and I was thinking of the consequences and I knew I had to make a statement and at the end of the day I did say that if he had done it, I would never want to see him again. The whole idea of being close to a murderer would, you know like any woman, feel absolutely appalling.

JT The impact on my life has been a hundred per cent disrupted since the Monday morning of my arrest. I cannot believe....what the .... it was about fourteen hours interrogation altogether because they did a two hour interview down here first with me before I had an inkling. Eoin was in a house nearby where he does his work about a field away and, um, so l knew nothing of what was going on with him and being arrested and I was in the kitchen and they were talking to me and then they suddenly came out with arresting me and I mean talk about wind out of your sails, I was knocked for six, I couldn't believe it. So, ah, about another hour and a half in the car, quite a lot of talking then, and then a solid twelve hours. I was offered a break but I couldn't see the point at the time because it was like the pressure to make me say things that I knew not to be true and the feeling was that they were coming back from another room where by this time I had seen Eoin arrested by way, I did know he was arrested, and in the building, um, coming through with information that he was admitting it and I was, I was getting more and more stunned. It was a horrific experience.

As regards her signed statement, in a letter from her solicitor Thomas formally withdrew it

Ms. Jules Thomas most emphatically will not, if called as a witness for the prosecution, confirm the statement allegedly made in Bandon Garda Station on the 10th day of February 1997. There are several matters in the statement which she claims are not accurate.

Jules Thomas' accusations are astounding, she is saying she was made to fear for her daughter's futures, if she didn't sign. Is this believable. In short, yes. The idea Gardai would resort to such tactics, lie to witnesses, coerce witnesses and generally falsify records is not unthinkable. As mentioned, there is a long and controversial history of Garda interrogations resulting in confessions. However, we need to examine the record of this interrogation to see if there is substance behind Thomas's claims.

Because we have custody records and memos for both Bailey’s and Thomas’s interrogations, we can analyse the interrogation throughout that day, hour by hour. In particular we can examine memos of Thomas’s interrogation and the final statement to decide if Thomas is justified when she accused the Gardai of falsifying her statement and pressuring her to sign.

Analysis - is Thomas's arrest record reliable?

There are five documents covering Jules Thomas’ arrest and each one is problematic in different ways.

The first is the custody sheet, which records the arrest and the various times Thomas was interviewed, offered coffee, met with her solicitor and so on. This document seems mundane, except for the fact that the member in charge has written the date as 10th January instead of 10th February on every single entry.

The next three are handwritten memos, purportedly taken at the time of interrogation, standard Garda practice at the time. Audio and/or video recording of interviews was not used at the time.

The final document is a statement and it is this statement that was central to the Garda attempt to try to get the DPP to charge Bailey.

First let’s look at thee memos. Just looking at the times we can see there is a major problem.

We know Thomas was interviewed at her home Prairie Cottage for 90 minutes before her arrest. There is no memo available for this period. No record whatsoever of what was said.

The second problem is that there are no memos for the seven hour period 4:50 until 00:50. This is extraordinary. Even though the Gardai did not tape record interviews, they were still required to keep a record. Thomas got to see a solicitor for 20 minutes

Thirdly, the memos look fishy. Each of these memos are hand written out in longhand. They are almost entirely free of mistakes and revisions. You would expect such fast-written notes to use some form of shorthand. In the cases where Garda Norma Keane took notes, this is partly true. Jules Thomas is shortened to JT, Kevin Kelleher is shortened to KK etc, but in the case of the memo taken by Kevin Kelleher, everything is written out in neat cursive without abbreviation. Every time he asks a question he prefaces it with his name neatly as “Gda K Kelleher” and her answer as “Jules Thomas” I find it difficult believe this form of laborious note-taking is possible without long pauses for the note-taker to catch up, or else things would be missed. It does not look like any of the other memos of any other suspect in all the other files.

The length of the memos is suspect. The first memo which is the longest one at 700 words covering the 45 minute period 1:45-2:30. Reading aloud through this memo takes no more than 5-6 minutes. Even if we assume some smalltalk curtailed here and there, there is a lot of time unaccounted for. The second memo has about 500 words accounting for a full hour of question and answer, just 13 question and answer pairs. There are a mere 480 words recorded for the third memo, which claims to cover 85 minutes of questioning. Even on the face of it, this record of four and a half hours of interrogation is difficult to believe.

Jules never signed the memos

But worse none of these memos were signed by Thomas. This is highly suspicious. In all other cases, in all other interviews and memos in the files and most notably in the case of Ian Bailey’s interviews all memos were signed by the interviewee. The memos of Ian Bailey’s interrogation look quite different, and are more believable. They do appear to have been written quickly. They are written in a fast scrawl notes and consequently they are sometimes difficult to read. The question and answer pairs are written quickly using “Q) & A)” not writing out in long hand the full name of the Garda and suspect on each line. There are abbreviated notes and sentence fragments such as “Caution.” “At Courtyard with Jules.” “General conversation.” “Repeatedly denied” where the note taker either couldn’t keep up or didn’t think all the words were relevant. There are corrections, crossed out words etc. This is exactly how you would expect rapidly taken notes to read. But most importantly each memo is signed by Ian Bailey as well as his Gardai interrogators.

Bailey’s signature was no mere formality. It was so important to the Gardai that the final memo of Bailey’s interrogation was signed at 0:05 on 11th of February, 90 minutes after Bailey was released from custody. Bailey couldn’t go home to the Prairie that night, so the Gardai dropped him at a the house of a friend, Russell Barrett. Witnesses reported Bailey arriving in in Skibbereen between 12 midnight and 00:30, Skibbereen is almost an hour’s drive from Bandon. Therefore Gardai, presumably very anxious to complete the paperwork, got Bailey to sign the memo in Skibbereen after he arrived.

Taken together with the fact that the memos do not look like they were written in the moment, the fact that Jules Thomas’s interrogation are not signed by her, suggests that the record was written down later. Was it a true representation of the the interviews? We cannot say, but as evidence in a murder trial they are worthless, we cannot trust them. However, we can use them to compare against each other and against the final statement. If these documents are not internally consistent, this is another marker that the record is false, and perhaps deliberately falsified.

Jules Thomas has maintained that a lot more was said than was recorded and disputes what was recorded in these statements.

On this evidence, her account is plausible. These memos cannot be regarded as an accurate record of the interrogation. The fact that the majority of her detention was not recorded at all is further evidence that the Gardai did not want to record the actual interviews preferring to get a signed statement.

The Statement is written in 'Garda Speak'

This statement is signed and dated 11th February at 11:50 AM, in the final few minute of Thomas’s legal detention period before she had to be released.

There is a single correction, where Fitzgerald accidently omitted some words from the legal caution.

Again the text is written in Garda speak

Some of the wording is so stilted and legalistic, it is clearly written by a Garda, and obviously not dictated by Thomas.

e.g.

“I don’t recall his absence during my further sleep”

“The Gardai have told me on this date that certain person or persons in the area saw Ian around Kealfadda Bridge on that Sunday Night”

“my concluding remark is that there is strong evidence to connect him with the murder of the French Lady.”

“I was privy to the conversation’s between Ian and Alfie that day”

Regular people don’t talk like this. This is pseudo legal Garda-speak.

When you see such word patterns in a statement, it indicates that the officer is writing the statement and not merely taking dictation. The suspect may be agreeing to the words from genuine assent, or whether the suspect is in fear or merely desires to please the law officer, but in either case it doesn’t matter. Once the law officer has added his or her own words to a statement it is irreparably prejudiced. The statement contains words written by the officer. Perhaps some of it comes from the suspect, perhaps none of it does, there is no way to tell which parts do and which parts do not. It is immaterial that Thomas signed it, because she signed it while clearly under duress.

Not only is this statement worthless from the point of view of establishing the truth, is serves to further confuse and muddy the waters, because it contains someone else’s words.

Contradictions between the statement and memos

But there is another reason to doubt this statement. There are contradictions between this statement and the earlier memos taken by Gardai during the actual interviews.

In this statement she is clear that she was the one driving to the scene on the afternoon of 23rd. She drove and Ian directed her. In memo #1 she could not remember who drove..

“I cannot remember if it was Ian or I who drove.”

She says in her earlier interviews that Ian didn’t leave the bed.

She says in her earlier interviews that she cannot remember what he was wearing on Sunday night but in the statement she lists it out in detail.

When the forensic results came back and there was nothing, the Gardai should have gone back to square one. In mid 1997, there was still hope and there were leads to check. But the tragedy is that they did not, they doubled down on their suspect and tried to use the community to convict Bailey.

The Second Arrest

This was not the only ordeal that Jules Thomas was put through. Bailey was arrested a second time on 27th January 1998. They didn't arrest Jules this time, perhaps because the DPP told them it would be illegal. However she was interviewed under caution at her own home for hours. This is remarkable, the Gardai actually interrogated Jules in her own home when she wasn’t even under arrest. The memo from this interview is 3000 words long. Even so it just went over old ground, turkeys, Hunt's Hill etc. Was Jules aware that she didn’t need to talk to the Gardai? Perhaps not, but this is not the behaviour of someone who has something to hide.

There is little to remark on during this second arrest. The Gardai focused on supposed admissions that Bailey had made and there was no progress.

By 2000 Jules and Bailey started to get their lives back. They had had a holiday in Crete. Bailey had sold an article on gardening to the Examiner.

Arrest of Fenella and Jules

But then, on 21 September 2000, Garda arrested Fenella Thomas at her student accommodation in Cork. She was 17 years old at the time and studying at University College Cork. The following day they arrested Jules again. The memos of the arrest of Fenella have nothing more in them beyond grilling her about whether it was her mother or Ian that she heard snoring on the morning of 23/12/1996, a detail which would be impossible to recall with certainty four years later. Of course the real reason was to put pressure on Jules via threatening her daughter and drive a wedge into her family. In this case the Gardai ignored a direction from the DPP that a second arrest of Thomas could be illegal.

Young as she was, Fenella seems to have been smarter than her mother or step-father. Taking advice from her solicitor she refused to sign anything put in front of her, and made no statement. So all we have from her arrest is Garda written memos, unsigned by her and again, suspiciously short. No new information came out of the interrogations.

This arrest of Jules and her youngest daughter is never mentioned in any of the documentaries or podcasts on the case. Psychologically though this arrest was particularly devastating for Thomas and her family.

Bandon Tapes - "we need her broken"

In 2014 it was revealed the Gardai were taping the phone lines of stations up and down the country.

It is incredibly ironic to think that at the time the Gardai were taping every phone line they never bothered to record suspect interviews on tape, instead using this ridiculous longhand which is clearly inadequate or worse, easy to change or falsify.

Most of the tapes were lost, but some of them survived and some of them pertained to the Sophie Toscan du Plantier murder. Garda Fitzgerald was caught on tape asking his superior Liam Hogan (the author of the first file sent to the DPP) whether he should tamper with a particular statement. Hogan was also annoyed that Fitzgerald's partner Garda Leahy had written a statement where he expressed an opinion that Jules was trying to be open and honest. Hogan was disgusted with this. Hogan was keenly aware that he needed to undermine Jules credibility, and Leahy's statement wasn't helping.

“Ah fuck it, it’s awful. When I see your friend then, like writing them stupid fucking statements, like I mean... what man... “I believe” he says “that she was doing her best to recall the night in question and being truthful.”

“Yes, that statement has to get fucking chopped up anyway.”

Hogan is clear, he wants this statement to disappear, hinting it might be bad for Leahy's career

"That statement is very damaging to have in there – I mean it’s not – it’s not – it doesn’t do himself any good anyway."

Fitzgerald cautions that you have to be careful about this. Leahy might get

“Then you have to go, to handle these fellas they get indignant, you have to be

careful with them, and so you better get it taken out without hurting feelings

type of thing.”

But undermining Jules' credibility wasn't enough, Hogan wanted to break her :

I tell you now unless we break Jules, who I think must have fucking something for us, we need her broken and we need to have it because if you stand back from it it is a very arguable, it is a 50/50.

Hogan knew if Bailey was guilty then Jules Thomas must know something. The trouble with this logic is that even at her lowest point, when Jules Thomas was temporarily persuaded that Ian had confessed on 10/02/1997, when Jules really was broken, she gave up all she had, and there was nothing to tell.

Even then it was only for a few hours. When she had time to think, she realized it was a stitch up, and went on Pat Kenny’s radio show to say so.

The art of getting a suspect to sign an incriminating statement is known as “verballing” and it can be done in various ways. One simple way is to read out the statement aloud to the suspect but alter the text somewhat as you read it. The statement is in the Garda’s handwriting after all. The Bandon tapes recorded Gardai explictly discussing verballing Ian Bailey. Here is an excerpt from Bandon Tape 48 recorded on 26 June 1997 between D/Sgt Liam Hogan and Supt Sean Camon. They are talking about the file they are sending to the DPP.

LIAM HOGAN: I think I suppose, the file won't be going into anybody though.

SEAN CAMON: Will it not?

LIAM HOGAN: No. That is the other thing I need to talk to you about, how receptive will they be in that office?

SEAN CAMON: If we are to do that?

LIAM HOGAN: Yeah. If you take it, if you were sitting in his desk and you get in this file and you say: You are very near it, lads, but you are not quite... It is almost saying like, now go and get your pen and verbal him or something fucking thing, you know. It is a position, you are putting them in a bit of a position I wonder. I just wonder how you approach it that is all.

SEAN CAMON: Who did you deal with before, was it Robert Sheehan?

LIAM HOGAN: Robert and...

SEAN CAMON: You're fucking going nowhere with him.

Other tapes talk about “pre-dating” statements “chopping up” statements they didn’t like. Garda corruption and tampering with evidence is not an outlandish possibility – it is very real.

Jules soldiers on

Where the Gardai left off, others took up, newspapers, true crime ghouls, hateful people who left dead rats and syringes in her letterbox, most recently there is an online gang of twitter trolls, Nick Foster who portrayed Jules as lying in his book “Murder at Roaringwater”, and Netflix who portayed Jules as Ian’s accomplice. Jules is now suing.

Even after kicking Bailey out, even after he has died, even after losing so much and standing by Bailey for years, publicly saying she “feels nothing” for him after his death – continues to maintain his innocence of the crime.

Ian Bailey voluntarily gave a fresh DNA sample a few weeks before he died so the FBI could test it against the exhibits, in the hope of clearing his name before he died. A second article on January 12 indicates the source is Kay Reynolds, Ian's sister.

This was the second DNA sample he gave. He gave a voluntary blood sample in 1997 but this sample was entirely used up in DNA tests conducted in 1997 & 2002.

Bailey died in January 2024. It is not mentioned if the FBI tested this sample or not.